WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00023525 Gene Name  Cbr-fbn-1
Sequence Name  ? CBG00005 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable calcium ion binding activity. Is an ortholog of C. elegans fbn-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

9 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG00005a.1 CBG00005a.1   [unknown]
Transcript:CBG00005f.1 CBG00005f.1   [unknown]
Transcript:CBG00005g.1 CBG00005g.1   [unknown]
Transcript:CBG00005h.1 CBG00005h.1   [unknown]
Transcript:CBG00005i.1 CBG00005i.1   [unknown]
Transcript:CBG00005b.1 CBG00005b.1   [unknown]
Transcript:CBG00005c.1 CBG00005c.1   [unknown]
Transcript:CBG00005d.1 CBG00005d.1   [unknown]
Transcript:CBG00005e.1 CBG00005e.1   [unknown]
 

Other

9 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG00005a CBG00005a   [unknown]
CDS:CBG00005b CBG00005b   [unknown]
CDS:CBG00005c CBG00005c   [unknown]
CDS:CBG00005d CBG00005d   [unknown]
CDS:CBG00005e CBG00005e   [unknown]
CDS:CBG00005f CBG00005f   [unknown]
CDS:CBG00005g CBG00005g   [unknown]
CDS:CBG00005h CBG00005h   [unknown]
CDS:CBG00005i CBG00005i   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day1_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-fbn-1, AATATTGAAAGCGGCGAGAGATACACGTTGACTGATGAGCAAGGGTGTGCAATTGATGAG, WBGene00023525   Expr1061758 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region