Genomics
8 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:Y119C1B.8e.1 | Y119C1B.8e.1 |
3000
 |
I: 4525961-4534799 |
| Transcript:Y119C1B.8h.1 | Y119C1B.8h.1 |
3010
|
I: 4525965-4534804 |
| Transcript:Y119C1B.8f.1 | Y119C1B.8f.1 |
2998
|
I: 4525966-4534799 |
| Transcript:Y119C1B.8b.1 | Y119C1B.8b.1 |
2986
|
I: 4525966-4534802 |
| Transcript:Y119C1B.8c.1 | Y119C1B.8c.1 |
2995
|
I: 4525966-4534805 |
| Transcript:Y119C1B.8a.1 | Y119C1B.8a.1 |
2987
|
I: 4525970-4534798 |
| Transcript:Y119C1B.8d.1 | Y119C1B.8d.1 |
2972
|
I: 4525984-4534800 |
| Transcript:Y119C1B.8g.1 | Y119C1B.8g.1 |
2709
|
I: 4526254-4534798 |
Other
8 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:Y119C1B.8b | Y119C1B.8b |
2553
|
I: 4526395-4526490 |
| CDS:Y119C1B.8g | Y119C1B.8g |
2568
|
I: 4526395-4526490 |
| CDS:Y119C1B.8h | Y119C1B.8h |
2574
|
I: 4526395-4526490 |
| CDS:Y119C1B.8a | Y119C1B.8a |
2562
|
I: 4526395-4526490 |
| CDS:Y119C1B.8c | Y119C1B.8c |
2559
|
I: 4526395-4526490 |
| CDS:Y119C1B.8d | Y119C1B.8d |
2559
|
I: 4526395-4526490 |
| CDS:Y119C1B.8e | Y119C1B.8e |
2565
|
I: 4526395-4526490 |
| CDS:Y119C1B.8f | Y119C1B.8f |
2568
|
I: 4526395-4526490 |
136 Allele
| Public Name |
|---|
| gk962706 |
| gk963902 |
| gk964159 |
| gk964070 |
| WBVar00248407 |
| WBVar00248405 |
| gk365236 |
| gk580405 |
| gk444394 |
| gk768419 |
| gk465936 |
| gk823142 |
| gk627316 |
| gk689899 |
| gk343359 |
| gk431498 |
| gk559893 |
| gk866507 |
| gk485423 |
| gk826206 |
| gk721188 |
| gk926830 |
| gk752895 |
| gk537158 |
| gk388917 |
| gk333512 |
| gk808892 |
| gk647072 |
| gk357140 |
| gk317356 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00022473 | 4525961 | 4534805 | -1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrI_4522814..4525960 | 3147 | I: 4522814-4525960 | Caenorhabditis elegans |
117 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Genes with expression altered >= 3-fold in dpy-10(e128) mutants. | Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). | WBPaper00035873:dpy-10_regulated | |
| Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:bodywall-muscle_L1-larva_expressed | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. | Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. | DESeq2 fold change > 2, p-value < 0.01. | WBPaper00061007:S.aquatilis_downregulated |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. | Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:S.aureus-4h_upregulated_N2 |
| Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. | CuffDiff, fold change > 2. | WBPaper00065096:Day10_vs_Day1_upregulated | |
| Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage. | DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. | WBPaper00066110:tetraploid_vs_diploid_downregulated | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:coelomocytes_L2-larva_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed | |
| Proteins interacting with HA-PPM-1.D. | N.A. | WBPaper00062498:PPM-1.D_interacting | |
| Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. | To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. | WBPaper00045521:Gender_Neutral | |
| Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C. | EdgeR, FDR < 0.05, fold change < 0.5. | WBPaper00055971:nhl-2(ok818)_25C_upregulated | |
| Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background. | DESeq2, FDR < 0.05 | WBPaper00060683:hlh-11(ko1)_downregulated | |
| Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. | Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. | Cuffcompare and Cuffdiff | WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047) |
9 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Original chronogram file: chronogram.597.xml | [Y119C1B.8:gfp] transcriptional fusion. | Chronogram1674 | ||
| Expr1159004 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr1013684 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Picture: Fig. S1B. | Expr9002 | GFP fluorescence was observed in most, if not all, cells, including the T, V5.pa, Z1/Z4 and Q cells, and all of their descendants. | The BET-1::GFP signal exhibited a granular distribution in the nuclei at interphase. During division, BET-1::GFP signals were observed along the metaphase plate, indicating that BET-1 colocalized with the chromosomes at mitosis. | |
| Expr2027853 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Strain: BC10117 | [Y119C1B.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTATGGAAGCTACTTTGTTCTA] 3' and primer B 5' [TGCCCTCAGAGATCTGAAAA] 3'. | Expr6895 | Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; unidentified cells; Larval Expression: body wall muscle; hypodermis; unidentified cells; | |
| Expr2040745 | Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690 | |||
| Expr1039933 | Tiling arrays expression graphs | |||
| Expr2009615 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). |
34 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| has_input(WB:WBGene00003515),occurs_in(WBbt:0003675) | involved_in |
| has_input(WB:WBGene00019947),occurs_in(WBbt:0007815) | involved_in |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| happens_during(WBls:0000060),has_input(WB:WBGene00003515) | involved_in |
| has_input(WB:WBGene00006754),occurs_in(WBbt:0003675),part_of(GO:0046716) | involved_in |
| has_input(WB:WBGene00003515),occurs_in(WBbt:0003675),part_of(GO:0046716) | involved_in |
| involved_in | |
| has_input(WB:WBGene00001184)|has_input(WB:WBGene00006353) | involved_in |
| has_input(WB:WBGene00000445),occurs_in(WBbt:0007815) | involved_in |
| happens_during(WBls:0000060) | involved_in |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| occurs_in(WBbt:0007815) | involved_in |
| involved_in |
14 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| least diverged orthologue |
34 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| has_input(WB:WBGene00003515),occurs_in(WBbt:0003675) | involved_in |
| has_input(WB:WBGene00019947),occurs_in(WBbt:0007815) | involved_in |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| happens_during(WBls:0000060),has_input(WB:WBGene00003515) | involved_in |
| has_input(WB:WBGene00006754),occurs_in(WBbt:0003675),part_of(GO:0046716) | involved_in |
| has_input(WB:WBGene00003515),occurs_in(WBbt:0003675),part_of(GO:0046716) | involved_in |
| involved_in | |
| has_input(WB:WBGene00001184)|has_input(WB:WBGene00006353) | involved_in |
| has_input(WB:WBGene00000445),occurs_in(WBbt:0007815) | involved_in |
| happens_during(WBls:0000060) | involved_in |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| occurs_in(WBbt:0007815) | involved_in |
| involved_in |
8 Regulates Expr Cluster
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in bet-1(uth41) animals comparing to in N2. | DESeq2, p-value < 0.05 and fold change > 2. | WBPaper00064735:bet-1(uth41)_vs_N2_downregulated | |
| Transcripts that showed significantly increased expression in bet-1(RNAi) animals comparing to in N2. | DESeq2, p-value < 0.05 and fold change > 2. | WBPaper00064735:bet-1(RNAi)_vs_N2_upregulated | |
| Transcripts that showed significantly increased expression in bet-1(uth41) animals comparing to in N2. | DESeq2, p-value < 0.05 and fold change > 2. | WBPaper00064735:bet-1(uth41)_vs_N2_upregulated | |
| Transcripts that showed significantly increased expression in bet-1B overexpression animals comparing to in N2. | DESeq2, p-value < 0.05 and fold change > 2. | WBPaper00064735:bet-1B(OE)_vs_N2_upregulated | |
| Transcripts that showed significantly increased expression in bet-1B(overexpression); mys-1(RNAi) animals comparing to in mys-1(RNAi). | DESeq2, p-value < 0.05 and fold change > 2. | WBPaper00064735:bet-1B(OE)mys-1(RNAi)_vs_mys-1(RNAi)_upregulated | |
| Transcripts that showed significantly decreased expression in bet-1B(overexpression); mys-1(RNAi) animals comparing to in mys-1(RNAi). | DESeq2, p-value < 0.05 and fold change > 2. | WBPaper00064735:bet-1B(OE)mys-1(RNAi)_vs_mys-1(RNAi)_downregulated | |
| Transcripts that showed significantly decreased expression in bet-1B overexpression animals comparing to in N2. | DESeq2, p-value < 0.05 and fold change > 2. | WBPaper00064735:bet-1B(OE)_vs_N2_downregulated | |
| Transcripts that showed significantly decreased expression in bet-1(RNAi) animals comparing to in N2. | DESeq2, p-value < 0.05 and fold change > 2. | WBPaper00064735:bet-1(RNAi)_vs_N2_downregulated |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrI_4534806..4537446 | 2641 | I: 4534806-4537446 | Caenorhabditis elegans |
