Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:T07H8.7.1 | T07H8.7.1 |
1113
 |
V: 6977670-6979119 |
Other
1 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:T07H8.7 | T07H8.7 |
1026
|
V: 6977754-6978095 |
22 Allele
| Public Name |
|---|
| gk963301 |
| gk963553 |
| gk964259 |
| gk964351 |
| gk963850 |
| gk964527 |
| gk962860 |
| gk964528 |
| gk238386 |
| gk238385 |
| gk410634 |
| gk407762 |
| gk436293 |
| gk423923 |
| gk617443 |
| gk374896 |
| gk798184 |
| gk777209 |
| gk923874 |
| gk630732 |
| gk493265 |
| gk559739 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00020333 | 6977670 | 6979119 | -1 |
3 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrV_6977388..6977669 | 282 | V: 6977388-6977669 | Caenorhabditis elegans |
13 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Single-cell RNA-Seq cell group 84_0 expressed in neuron. | scVI 0.6.0 | WBPaper00065841:84_0 | |
| Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. | DESEQ2, fold change > 2 and FDR < 0.01. | WBPaper00062103:neuron_enriched | |
| Bacteria infection: Enterococcus faecalis | Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. | For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. | WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray |
| Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. | N.A. | WBPaper00026929:sir-2.1_overexpression_regulated | |
| Transcripts that showed differential expression in dauer N2 vs dauer mir-34(gk437) animals at 20C. | N.A. | WBPaper00050488:N2_vs_mir-34(gk437)_regulated_dauer_20C | |
| Drug treatment: Elbe sediment | Genes with significantly changing transcripts in C. elegans exposed to the Elbe (E) sediment. | [ANOVA, p < 0.05 without multiple sample correction, fold-change to reference sediment Danube (D) > 1.4 (up-regulated) or < 0.7 (down-regulated)]. | WBPaper00033070:Elbe_upregulated |
| Transcripts that showed significantly decreased expression in drh-3(rrr2) comparing to in N2. | edgeR, log2 fold change > 2 or < -2. | WBPaper00053888:drh-3(rrr2)_downregulated | |
| Top 300 transcripts enriched in XXXL, XXXR according to single cell RNAseq. | Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. | WBPaper00061340:XXX | |
| Transcripts that showed significantly increased expression in Day 8 adults comparing to in Day 1 adults in intestine cells. | t-test, fold change > 2, p-value < 0.01. | WBPaper00062590:Aging_upregulated_intestine | |
| Coexpression clique No. 282, srj-21-srh-32, on the genome-wide coexpression clique map for the nematode GPL200 platform. | All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. | WBPaper00061527:srj-21-srh-32 | |
| Single-cell RNA-Seq cell group 101_0 expressed in neuron. | scVI 0.6.0 | WBPaper00065841:101_0 | |
| Single-cell RNA-Seq cell group 35_3 expressed in neuron. | scVI 0.6.0 | WBPaper00065841:35_3 |
5 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr2034495 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Strain: BC12198 | [T07H8.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTATTGAAAGAATTCAGGGCA] 3' and primer B 5' [TGGAGGAGCAGGATTGACA] 3'. | Expr6635 | Adult Expression: intestine; Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons; | |
| Expr1156417 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr1022849 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2016266 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrV_6979120..6980590 | 1471 | V: 6979120-6980590 | Caenorhabditis elegans |
