WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00019478 Gene Name  cri-2
Sequence Name  ? K07C11.5 Brief Description  K07C11.5 is orthologous to the human gene SIMILAR TO TISSUE INHIBITOR OF METALLOPROTEINASE 3 (SORSBY FUNDUS DYSTROPHY, PSEUDOINFLAMMATORY) (TIMP3; OMIM:188826), which when mutated leads to disease.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable metalloendopeptidase inhibitor activity. Predicted to be involved in negative regulation of membrane protein ectodomain proteolysis. Predicted to be located in extracellular matrix and extracellular space. Expressed in several structures, including enteric muscle; gonad; hyp12; nerve ring; and tail hypodermis. Human ortholog(s) of this gene implicated in several diseases, including Alzheimer's disease; Duchenne muscular dystrophy; artery disease (multiple); reproductive organ cancer (multiple); and urinary system cancer (multiple). Is an ortholog of human TIMP2 (TIMP metallopeptidase inhibitor 2).
Biotype  SO:0001217 Genetic Position  V :1.196 ±0.008873
Length (nt)  ? 716
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene is in one list:
metrics_list_union (10192)

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00019478

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:K07C11.5.1 K07C11.5.1 531   V: 8201808-8202523
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:K07C11.5 K07C11.5 477   V: 8201808-8202032

5 RNAi Result

WormBase ID
WBRNAi00050124
WBRNAi00016703
WBRNAi00033552
WBRNAi00089115
WBRNAi00075833

14 Allele

Public Name
gk963301
gk964351
gk962860
gk964047
gk964046
gk240922
h13094
gk314
gk348
gk919288
gk636436
gk779746
gk453938
ok928

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier 		Start End Strand
WBGene00019478 8201808 8202523 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_8202524..8203331   808 V: 8202524-8203331 Caenorhabditis elegans

195 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
  Transcripts that showed significantly increased expression in pri-1(RNAi) animals comparing to in N2 animals fed with empty vector. Differential expression analysis was performed quasi-likelihood F-test with the generalized linear model (GLM) approach in edgeR ver 3.32.1. FDR < 0.05, fold change > 2. WBPaper00066418:pri-1(RNAi)_upregulated
  Developmentally modulated gene cluster. self-organizing map cgc4386_cluster_1_5
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
  Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage. DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
  Transcripts that showed significantly increased expression in hda-1(RNAi) embryos comparing to control animals. DESeq2, fold change > 2, FDR < 0.05. WBPaper00067044:hda-1(RNAi)_upregulated
Bacteria: Pseudomonas donghuensis HYS Transcripts that showed significantly increased expression after 24 hours of infection by Pseudomonas donghuensis HYS with deletion of ferric uptake regulator (FUR), comparing to control animals exposed to OP50. DESeq2, fold change > 2, FDR < 0.05. WBPaper00068216:FUR_vs_OP50_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Proteins interacting with GST-FBXA-210(C-terminal) via IP-MS in young adult animals. Proteins shown here are enriched in GST Fold change > 2 and p-value < 0.1 were defined as threshold for significance. WBPaper00068277:FBXA-210(C-terminal)_interacting_YoungAdult
  Transcripts that showed significantly decreased expression in morc-1(tm6048) animals, comparing to in N2, after growing at 25C for five generations (late generation). CuffDiff2 WBPaper00051265:F4_morc-1(tm6048)_downregulated
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed signifcantly increased expression in pabp-2(RNAi) animals comparing to in N2 animals injected with empty vector at L1 larva stage and collected at L4 larva stage. FDR < 0.05, fold change > 2 WBPaper00067368:pabp-2(RNAi)_upregulated_N2
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
  Genes with increased RNA expression after 24 hours rotenone treatment EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed. WBPaper00044426:rotenone_24h_upregulated
Starvation Starvation-induced transcripts that showed significantly increased expression in post dauer animals comparing to wild type control. edgeR WBPaper00053713:Starvation-induced_postdauer_vs_control_upregulated
  Transcripts that showed significantly decreased expression in strain GC1459 containing daf-18(ok480) comparing to control strain GC1171. edgeR, p-value < 0.05, fold change > 2. WBPaper00061699:daf-18(ok480)_downregulated

9 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4930 strong bwm, vul, anal, rare ant pharynx, bwm precursors, tail hyp, neurons; early embryonic bwm at least by horseshoe stage  
Also expressed in (comments from author) : low intensity GFP expression. Strain: BC13623 [tag-225::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCACCAAAACTTTACGATCACG] 3' and primer B 5' [AAATTTTGGATCTGAAAATGGAAT] 3'. Expr6345 Adult Expression: body wall muscle; Larval Expression: body wall muscle;  
    Expr14700 TIMP-1::Venus was detected on the gonadal basement membrane of the L3-stage larvae and on the basement membrane of somatic gonads and the plasma membrane of germ cells, including oocytes, of young adults. When CRI-2::Venus was expressed from the transgene tjTi86[cri-2p::cri-2::Venus], it also had a similar localization pattern. In the head region, TIMP-1::Venus and CRI-2::Venus localized to the basement and plasma membrane of the pharyngeal cells, and at the nerve ring. We then asked whether TIMP-1 and CRI-2 are secreted by examining the endocytic uptake of TIMP-1::Venus and CRI-2::Venus by coelomocytes, which are scavenger cells in the pseudocoelom. Accumulation of TIMP-1::Venus and CRI-2::Venus was observed in coelomocytes of these transgenic strains, suggesting that TIMP-1 and CRI-2 were secreted.  
    Expr1153825 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2010531 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1038415 Tiling arrays expression graphs  
    Expr1026268 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2028771 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.2271.xml [K07C11.5:gfp] transcriptional fusion. Chronogram1148    

10 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  enables
  enables
  enables
  enables
  enables
  involved_in
  located_in

16 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier 		Start End Strand
WBGene00019478 8201808 8202523 1

10 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  enables
  enables
  enables
  enables
  enables
  involved_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
716

1 Sequence Ontology Term

Identifier Name Description
gene  

4 Strains

WormBase ID
WBStrain00031717
WBStrain00036108
WBStrain00036008
WBStrain00002668

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_8199095..8201807   2713 V: 8199095-8201807 Caenorhabditis elegans