Genomics
7 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:F52E1.13a.1 | F52E1.13a.1 |
3053
 |
V: 8415648-8438409 |
| Transcript:F52E1.13e.1 | F52E1.13e.1 |
2991
|
V: 8415686-8444770 |
| Transcript:F52E1.13b.1 | F52E1.13b.1 |
1950
|
V: 8415687-8422851 |
| Transcript:F52E1.13f.1 | F52E1.13f.1 |
2951
|
V: 8415687-8434307 |
| Transcript:F52E1.13g.1 | F52E1.13g.1 |
2957
|
V: 8415687-8434307 |
| Transcript:F52E1.13c.1 | F52E1.13c.1 |
3019
|
V: 8415688-8444806 |
| Transcript:F52E1.13d.1 | F52E1.13d.1 |
1938
|
V: 8422660-8438409 |
Other
7 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F52E1.13a | F52E1.13a |
2523
|
V: 8416178-8416293 |
| CDS:F52E1.13b | F52E1.13b |
1323
|
V: 8416178-8416293 |
| CDS:F52E1.13e | F52E1.13e |
2499
|
V: 8416178-8416293 |
| CDS:F52E1.13f | F52E1.13f |
2460
|
V: 8416178-8416293 |
| CDS:F52E1.13g | F52E1.13g |
2466
|
V: 8416178-8416293 |
| CDS:F52E1.13c | F52E1.13c |
2493
|
V: 8416178-8416293 |
| CDS:F52E1.13d | F52E1.13d |
1938
|
V: 8422660-8422736 |
376 Allele
| Public Name |
|---|
| gk963301 |
| otn8921 |
| WBVar02060355 |
| WBVar02060356 |
| WBVar02060357 |
| WBVar02060358 |
| WBVar02060359 |
| gk964351 |
| gk962860 |
| gk964052 |
| otn12425 |
| otn12424 |
| otn12426 |
| otn11420 |
| otn11421 |
| WBVar01863033 |
| WBVar01863036 |
| WBVar01863037 |
| WBVar01863034 |
| WBVar01863035 |
| WBVar01863038 |
| WBVar01863039 |
| WBVar01863040 |
| WBVar01863043 |
| WBVar01863044 |
| WBVar01863041 |
| WBVar01863042 |
| WBVar01974429 |
| WBVar01974428 |
| WBVar01974427 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00018700 | 8415648 | 8444806 | -1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrV_8415255..8415647 | 393 | V: 8415255-8415647 | Caenorhabditis elegans |
145 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_age_regulated_developing | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). | Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. | WBPaper00040858:eQTL_regulated_reproductive | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20) | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141) | |
| Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20) | |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. | Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:S.aureus-4h_upregulated_N2 |
| Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines. | RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1. | WBPaper00035269:cde-1_regulated | |
| Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. | DESeq | WBPaper00053302:stavudine_24h_regulated | |
| Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. | Cufflinks | WBPaper00065120:body-muscle-transcriptome | |
| Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:daf-2(e1370)_upregulated | |
| Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:nuo-6(qm200)_upregulated | |
| Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain. | RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis. | WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR | |
| Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin-Allantoin_downregulated | |
| Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin_downregulated | |
| Bacteria: B.thuringiensis | Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. | Cuffdiff | WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi) |
| Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. | To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. | WBPaper00045521:Gender_Neutral | |
| Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin. | N.A. | WBPaper00055862:antimycin_damt-1(gk961032)_regulated |
8 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Strain: BC10281 | [F52E1.13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGCTTTAACGTCTGGAGAG] 3' and primer B 5' [TGAGAGTCCACGGAGAGACC] 3'. | Expr6139 | Adult Expression: pharynx; intestine; hypodermis; Nervous System; nerve ring; head neurons; unidentified cells in head; Larval Expression: pharynx; intestine; hypodermis; Nervous System; nerve ring; head neurons; unidentified cells in head; | |
| Expr1151797 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr11829 | Under normal conditions without juglone, a superoxide generating agent, the oxr1::GFP gene was markedly expressed in the head and intestine. | |||
| Expr1038049 | Tiling arrays expression graphs | |||
| Expr1024597 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2013232 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr2031463 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr2041711 | Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690 |
7 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in |
14 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| least diverged orthologue |
7 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrV_8444807..8446606 | 1800 | V: 8444807-8446606 | Caenorhabditis elegans |
