Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:F22A3.1b.1 | F22A3.1b.1 |
2230
 |
X: 6518936-6522656 |
| Transcript:F22A3.1a.1 | F22A3.1a.1 |
1884
|
X: 6519819-6522667 |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F22A3.1b | F22A3.1b |
1392
|
X: 6519032-6519047 |
| CDS:F22A3.1a | F22A3.1a |
1131
|
X: 6519819-6519878 |
58 Allele
| Public Name |
|---|
| gk964260 |
| gk962713 |
| gk375971 |
| gk528481 |
| gk856598 |
| gk786918 |
| gk382493 |
| gk358089 |
| gk920490 |
| gk410722 |
| gk817144 |
| gk666267 |
| gk797843 |
| gk703614 |
| gk660640 |
| gk729246 |
| gk403268 |
| gk667945 |
| gk645480 |
| gk555947 |
| gk706712 |
| gk319740 |
| gk378133 |
| gk337851 |
| gk743164 |
| gk761771 |
| gk388537 |
| gk923357 |
| gk760886 |
| gk460702 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00017687 | 6518936 | 6522667 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
227 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Genes with expression altered >= 3-fold in dpy-10(e128) mutants. | Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). | WBPaper00035873:dpy-10_regulated | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_NoFood |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. | edgeR, fold change > 2, FDR < 0.05 | WBPaper00060909:atfs-1(cmh15)_downregulated | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141) | |
| Transcripts that showed significantly increased expression after 24 hours of induction of human beta Amyloid at young adult stage | A 2-fold change in expression level and a false discovery rate analog of p < 0.05. | WBPaper00064130:Beta-Amyloid_24h_upregulated_mRNA | |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. | Fold change > 2. | WBPaper00064306:Agaro-oligosaccharides_upregulated | |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| starvation 12 hours | Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals. | EdgeR, FDR < 0.05, fold change >= 2. | WBPaper00067259:starvation_upregulated_intestine |
| Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_N2-background | |
| Transcripts that showed significantly increased expression at the intestine cells of daf-2(e1370) comparing to the intestine cells of N2 animals at L2 larva stage. | DESeq2 (version 1.24.0), fold change >= 2, FDR < 0.05 | WBPaper00064632:daf-2(e1370)_upregulated_intestine | |
| Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. | DESeq fold change > 2, FDR < 0.05. | WBPaper00067499:Day7_vs_Day1_downregulated_Illumina | |
| Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. | DESeq fold change > 2, FDR < 0.05. | WBPaper00067499:Day10_vs_Day1_downregulated_Illumina | |
| Transcripts that showed significantly decreased expression in N2 day 15 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. | DESeq fold change > 2, FDR < 0.05. | WBPaper00067499:Day15_vs_Day1_downregulated_Illumina | |
| Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated | |
| Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00065975:P-body_vs_WholeAnimal_depleted | |
| Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage. | DESeq2, fold change > 2 | WBPaper00058725:sftb-1(cer6)_downregulated | |
| Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. | Cufflinks | WBPaper00065120:body-muscle-transcriptome | |
| Genes with increased RNA expression after 24 hours rotenone treatment | EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed. | WBPaper00044426:rotenone_24h_upregulated | |
| Temprature shift to 28C for 48 hours. | Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours. | Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. | WBPaper00061341:28C_48h_downregulated |
11 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Also expressed in (comments from author) : High intensity GFP interferes with tissue identification Strain: BC10608 | [F22A3.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTGAAAAATTTCCCCGTAGG] 3' and primer B 5' [TAAGCAGCAGTCATATTGAACAGT] 3'. | Expr5820 | Adult Expression: pharynx; intestine; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; intestine; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; | |
| Picture: Fig 4. | Expr9131 | Robust GFP expression for both constructs was observed in the intestinal cells of transgenic worms starting at the 3-fold embryonic stage and was maintained through larval development and in the adult. GFP expression was also seen in several cells of the anterior and posterior bulbs of the pharynx and in seam cells. Lastly, ets-4 expression was observed in a few unidentified cells of the vulva, hypodermal nuclei, several unidentified neurons, labial socket cells of the head, and a few cells of the rectum. Thus, these results expanded the observations made in previous studies using shorter regions of the ets-4 promoter in GFP constructs and demonstrated ets-4 expression in the intestine and neurons, key tissues known to regulate longevity in worms. | ||
| Clone: pUL#JS9A5 | Expr7515 | Expression is seen in the full length of the intestine from late embryo onwards. Only two lines were obtained for this reporter gene fusion but both show the same pattern of expression. | ||
| Expr12966 | ets-4 showed pan-germline expression. Reporter expression was observed in the distal region of the germline, in mitotic progenitor cells, as well as in the syncytial region, in the germline bend, in oocytes, and in embryos. ets-4 reporter expression remained strong in sperm (n=12/23), suggesting that at least some 3'UTRs can direct retention of sperm specific expression. | |||
| No detailed description on expression patterns in other life stages. Reporter gene fusion type not specified. | Expr2425 | In adult hermaphrodites, F22A3.1 reporter expression was observed in the inner and outer labial socket cells of the head. F22A3.1 is expressed strongly in the seam cells within the hypodermal ridges, which extend bilaterally along the length of the exterior body wall. During the first larval stage, F22A3.1 also demonstrated expression in P-cells, the ventral hypodermal precursors, some of which form the vulva. In general, F22A3.1 seems to be quite specific to hypodermal tissues and is probably expressed in all hypodermal cells including glial-like cells. | ||
| Expr2011380 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1037592 | Tiling arrays expression graphs | |||
| Expr1010864 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Original chronogram file: chronogram.2410.xml | [F22A3.1:gfp] transcriptional fusion. | Chronogram1291 | ||
| Expr1149192 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr2029616 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). |
18 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00020504),part_of(GO:0048691) | involved_in |
| occurs_in(WBbt:0005409) | involved_in |
| located_in | |
| has_input(WB:WBGene00020504),part_of(GO:0048691) | enables |
| enables | |
| has_input(WB:WBGene00020504),part_of(GO:0048691) | enables |
| enables | |
| enables | |
| enables | |
| located_in | |
| located_in | |
| located_in | |
| part_of |
5 Homologues
| Type |
|---|
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
18 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00020504),part_of(GO:0048691) | involved_in |
| occurs_in(WBbt:0005409) | involved_in |
| located_in | |
| has_input(WB:WBGene00020504),part_of(GO:0048691) | enables |
| enables | |
| has_input(WB:WBGene00020504),part_of(GO:0048691) | enables |
| enables | |
| enables | |
| enables | |
| located_in | |
| located_in | |
| located_in | |
| part_of |
4 Regulates Expr Cluster
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Genes upregulated in ets-4(ok165) compared to wild-type (WT) worms. | The log ratios were analyzed using the Rank Products method to identify consistently differentially expressed genes. Genes were selected using a probability of false prediction (PFP) cut off of 0.1, i.e. a false discovery rate of 10%. This technique corrects for multiple testing with repeated trials on random permutations of the data set. | WBPaper00037624:ets-4(ok165)_upregulated | |
| Transcripts that showed significantly increased expression in ets-4(rrr16) comparing to in N2 animals. | Fold change > 2. | WBPaper00064473:ets-4(rrr16)_upregulated | |
| Genes downregulated in ets-4(ok165) compared to wild-type (WT) worms. | The log ratios were analyzed using the Rank Products method to identify consistently differentially expressed genes. Genes were selected using a probability of false prediction (PFP) cut off of 0.1, i.e. a false discovery rate of 10%. This technique corrects for multiple testing with repeated trials on random permutations of the data set. | WBPaper00037624:ets-4(ok165)_downregulated | |
| Transcripts that showed significantly decreased expression in ets-4(rrr16) comparing to in N2 animals. | Fold change > 2. | WBPaper00064473:ets-4(rrr16)_downregulated |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrX_6517284..6518935 | 1652 | X: 6517284-6518935 | Caenorhabditis elegans |
