Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:C03G5.1.1 | C03G5.1.1 |
2400
 |
X: 8542757-8546021 |
Other
1 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:C03G5.1 | C03G5.1 |
1941
|
X: 8543210-8543446 |
50 Allele
| Public Name |
|---|
| gk964260 |
| gk962707 |
| gk963896 |
| gk963732 |
| gk964126 |
| gk964401 |
| gk964402 |
| WBVar02065212 |
| h12996 |
| tm2080 |
| gk801049 |
| gk564302 |
| gk803941 |
| gk747656 |
| gk934882 |
| gk922726 |
| gk733334 |
| gk682347 |
| gk413143 |
| gk912042 |
| gk598917 |
| gk450738 |
| gk702224 |
| gk759519 |
| gk542822 |
| gk615212 |
| gk589644 |
| gk418962 |
| gk758859 |
| WBVar01550717 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00015391 | 8542757 | 8546021 | -1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrX_8542284..8542756 | 473 | X: 8542284-8542756 | Caenorhabditis elegans |
195 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
| TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. | SAM | WBPaper00031040:TGF-beta_adult_upregulated | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_NoFood |
| Proteins detected in isolated mitochondria. | N.A. | WBPaper00067939:mitochondria_expressed_protein | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. | edgeR, fold change > 2, FDR < 0.05 | WBPaper00060909:atfs-1(cmh15)_downregulated | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
| Bacteria infection: Bacillus thuringiensis | Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. | N.A. | WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Proteins interacting with GST-FBXA-210(C-terminal) via IP-MS in young adult animals. Proteins shown here are enriched in GST | Fold change > 2 and p-value < 0.1 were defined as threshold for significance. | WBPaper00068277:FBXA-210(C-terminal)_interacting_YoungAdult | |
| Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. | DESeq2(v1.32.0), FDR < 0.05. | WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs | |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| Transcripts that showed significantly decreased expression in vit-2(ac3); zcIs4, comparing to parenting strain SJ4005 [zcIs4]. | Differential gene expression analysis was then performed on normalized samples. Genes exhibiting at least twofold change and a false-discovery rate (FDR) of 1% or less were considered differentially expressed. | WBPaper00051305:vit-2(ac3)_downregulated | |
| Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. | DESeq2 version 1.22.2, p < 0.05 | WBPaper00064716:paraquat_downregulated | |
| Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals. | NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%. | WBPaper00064727:daf-2(e1370)_upregulated | |
| Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. | Sleuth | WBPaper00051558:aging_regulated |
17 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Strain: BC12748 | [C03G5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGGCTATCCAATGGTTTCT] 3' and primer B 5' [CGGCTCGGAGGATTTTTC] 3'. | Expr5130 | Adult Expression: pharynx; intestine; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; tail neurons; unidentified cells in head; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; tail neurons; unidentified cells in head; | |
| Strain: BC12851 | [C03G5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGGCTATCCAATGGTTTCT] 3' and primer B 5' [CGGCTCGGAGGATTTTTC] 3'. | Expr5131 | Adult Expression: pharynx; intestine; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; | |
| Strain: DM12851 | [C03G5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGGCTATCCAATGGTTTCT] 3' and primer B 5' [CGGCTCGGAGGATTTTTC] 3'. | Expr5132 | Adult Expression: pharynx; intestine; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; intestine; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; | |
| Also expressed in (comments from author) : Adult and larval have expression in either the seam cells or H cell but it was difficult to determine. There is also occassional mosaic expression in the body wall muscle. Strain: BC10570 | [C03G5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGGCTATCCAATGGTTTCT] 3' and primer B 5' [CGGCTCGGAGGATTTTTC] 3'. | Expr5133 | Adult Expression: pharynx; intestine; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; intestine; body wall muscle; Nervous System; head neurons; tail neurons; unidentified cells; | |
| Strain: BC10585 | [C03G5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGGCTATCCAATGGTTTCT] 3' and primer B 5' [CGGCTCGGAGGATTTTTC] 3'. | Expr5128 | Adult Expression: pharynx; intestine; excretory cell; Nervous System; tail neurons; Larval Expression: pharynx; intestine; Nervous System; tail neurons; | |
| Strain: BC12702 | [C03G5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGGCTATCCAATGGTTTCT] 3' and primer B 5' [CGGCTCGGAGGATTTTTC] 3'. | Expr5129 | Adult Expression: pharynx; intestine; body wall muscle; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells; Larval Expression: pharynx; intestine; body wall muscle; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons; | |
| Expr15029 | A 500-bp region upstream of the first sdha-1 ATG start codon drives sdha-1 expression in the pharynx, epidermis, body wall muscles, and intestine. | |||
| Expr1036589 | Tiling arrays expression graphs | |||
| Original chronogram file: chronogram.1951.xml | [C03G5.1:gfp] transcriptional fusion. | Chronogram904 | ||
| Original chronogram file: chronogram.1689.xml | [C03G5.1:gfp] transcriptional fusion. | Chronogram660 | ||
| Original chronogram file: chronogram.376.xml | [C03G5.1:gfp] transcriptional fusion. | Chronogram1502 | ||
| Expr1018331 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2033895 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1143633 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Original chronogram file: chronogram.2142.xml | [C03G5.1:gfp] transcriptional fusion. | Chronogram1077 | ||
| Expr2044688 | Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690 | |||
| Expr2015662 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). |
21 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| part_of | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| contributes_to | |
| enables | |
| enables |
8 Homologues
| Type |
|---|
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| least diverged orthologue |
| orthologue |
| least diverged orthologue |
21 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| part_of | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| contributes_to | |
| enables | |
| enables |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrX_8546022..8546075 | 54 | X: 8546022-8546075 | Caenorhabditis elegans |
