Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:Y113G7B.17.1 | Y113G7B.17.1 |
1278
 |
V: 20267377-20269711 |
| Transcript:Y113G7B.17.2 | Y113G7B.17.2 |
1176
|
V: 20267450-20269713 |
Other
1 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:Y113G7B.17 | Y113G7B.17 |
1047
|
V: 20267601-20267756 |
73 Allele
| Public Name |
|---|
| gk963271 |
| WBVar02124844 |
| gk964176 |
| gk962705 |
| gk963489 |
| gk963304 |
| WBVar02122714 |
| WBVar02124642 |
| gk963809 |
| gk962663 |
| otn12529 |
| gk964279 |
| gk964280 |
| WBVar00072770 |
| WBVar00072769 |
| WBVar00072767 |
| WBVar00072768 |
| WBVar02026166 |
| WBVar01829788 |
| WBVar01829789 |
| WBVar01829790 |
| WBVar01829791 |
| WBVar02071387 |
| tm3613 |
| WBVar01877635 |
| WBVar01941258 |
| WBVar01941257 |
| gk959715 |
| gk641550 |
| WBVar01526109 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00013766 | 20267377 | 20269713 | -1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrV_20267248..20267376 | 129 | V: 20267248-20267376 | Caenorhabditis elegans |
185 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_NoFood |
| Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin-Allantoin_upregulated | |
| Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). | DESeq2, fold change >= 2, FDR <= 0.01. | WBPaper00056826:SGP_biased | |
| Starvation 48 hours at L1 arrest | Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest) | Fold change > 2. | WBPaper00064005:starvation_upregulated_N2_mRNA |
| Fungi infection: Myzocytiopsis humicola | Transcripts that showed significantly altered expression 12 hours after animals were infected by M. humicola. | Differentially expressed genes as determined by Kallisto and Sleuth (pval<0.01, qval<0.1). | WBPaper00060871:M.humicola-infection_12h_regulated |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Bacteria: Pseudomonas donghuensis HYS | Transcripts that showed significantly increased expression after 24 hours of infection by Pseudomonas donghuensis HYS with deletion of ferric uptake regulator (FUR), comparing to control animals exposed to HYS. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00068216:FUR_vs_HYS_upregulated |
| Bacteria: Pseudomonas donghuensis HYS | Transcripts that showed significantly decreased expression after 24 hours of infection by Pseudomonas donghuensis HYS, comparing to control animals exposed to OP50. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00068216:HYS_vs_OP50_downregulated |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| starvation 12 hours | Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals. | EdgeR, FDR < 0.05, fold change >= 2. | WBPaper00067259:starvation_upregulated_intestine |
| Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. | Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:S.aureus-4h_upregulated_N2 |
| Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. | DESeq | WBPaper00053302:stavudine_24h_regulated | |
| Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00065975:P-body_vs_oocyte_depleted | |
| Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00065975:P-body_vs_WholeAnimal_depleted | |
| Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells. | Log2 Fold change > 2 or <-1, p-value < 0.05. | WBPaper00053599:oocyte_vs_mitosis_upregulated | |
| Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. | Cufflinks | WBPaper00065120:body-muscle-transcriptome | |
| Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C. | Transcripts that showed significantly increased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00058948:PA14_upregulated |
11 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Also expressed in (comments from author) : L1s have high intensity GFP, later stages progressively lose intensity Strain: BC13727 | [Y113G7B.17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCAAGTCGTCTGACATGATT] 3' and primer B 5' [CCCGCTGGAAAAAGGTTAAT] 3'. | Expr6888 | Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |
| Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated.Strain not available. Strain: BC10240 | [Y113G7B.17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCAAGTCGTCTGACATGATT] 3' and primer B 5' [AGTCGACCTGCAGGCATGCAAGCT CCCGCTGGAAAAAGGTTAAT] 3'. | Expr6889 | Adult Expression: pharynx; anal depressor muscle; unidentified cells in head; Larval Expression: pharynx; intestine; unidentified cells in head; | |
| Expr9291 | Pprmt-1::gfp expression was observed in the pharynx, body wall muscle, and intestine during larval to adult development. | |||
| Operon: CEOP5508 | Expr9560 | Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons. Larval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | Sub-cellular localization within the body wall muscle: Endoplasmic reticulum (ER) +/- Other | |
| Expr11360 | At postembryonic stages, epg-11::gfp was widely expressed, including in pharyngeal, body wall muscle, intestinal, and vulval cells. | EPG-11::GFP was diffusely localized in the cytoplasm during embryogenesis. | ||
| Expr2033335 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr2044438 | Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690 | |||
| Expr1036168 | Tiling arrays expression graphs | |||
| Expr1158913 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr2015098 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1023532 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
36 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| part_of(WBbt:0006804) | located_in |
| has_input(WB:WBGene00004932)|has_input(WB:WBGene00004798)|has_input(WB:WBGene00003473)|has_input(WB:WBGene00003096) | involved_in |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00001502) | involved_in |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00000912) | involved_in |
| involved_in | |
| enables | |
| enables | |
| has_input(WB:WBGene00003992)|has_input(WB:WBGene00003994) | enables |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00004932)|has_input(WB:WBGene00004798)|has_input(WB:WBGene00003473)|has_input(WB:WBGene00003096) | involved_in |
| enables | |
| has_input(WB:WBGene00001881) | enables |
16 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| orthologue |
36 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| part_of(WBbt:0006804) | located_in |
| has_input(WB:WBGene00004932)|has_input(WB:WBGene00004798)|has_input(WB:WBGene00003473)|has_input(WB:WBGene00003096) | involved_in |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00001502) | involved_in |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00000912) | involved_in |
| involved_in | |
| enables | |
| enables | |
| has_input(WB:WBGene00003992)|has_input(WB:WBGene00003994) | enables |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00004932)|has_input(WB:WBGene00004798)|has_input(WB:WBGene00003473)|has_input(WB:WBGene00003096) | involved_in |
| enables | |
| has_input(WB:WBGene00001881) | enables |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrV_20269714..20270106 | 393 | V: 20269714-20270106 | Caenorhabditis elegans |
