Genomics
5 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:R11A5.4a.1 | R11A5.4a.1 |
2447
 |
I: 7866136-7872100 |
| Transcript:R11A5.4a.2 | R11A5.4a.2 |
2275
|
I: 7866249-7872080 |
| Transcript:R11A5.4d.1 | R11A5.4d.1 |
1857
|
I: 7866556-7871883 |
| Transcript:R11A5.4b.1 | R11A5.4b.1 |
2889
|
I: 7869096-7872077 |
| Transcript:R11A5.4c.1 | R11A5.4c.1 |
1764
|
I: 7870027-7871883 |
Other
4 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:R11A5.4a | R11A5.4a |
1965
|
I: 7866401-7866436 |
| CDS:R11A5.4b | R11A5.4b |
1890
|
I: 7869901-7871132 |
| CDS:R11A5.4c | R11A5.4c |
1764
|
I: 7870027-7871132 |
| CDS:R11A5.4d | R11A5.4d |
1857
|
I: 7866556-7866588 |
66 Allele
| Public Name |
|---|
| gk962858 |
| gk962706 |
| gk963902 |
| gk963849 |
| gk964316 |
| otn10685 |
| gk962622 |
| WBVar01432193 |
| gk962720 |
| WBVar02122894 |
| gk953921 |
| WBVar02072890 |
| WBVar02072889 |
| WBVar02072222 |
| ttTi17361 |
| ttTi21918 |
| WBVar00537723 |
| gk658297 |
| gk115793 |
| gk115794 |
| WBVar01902414 |
| gk940008 |
| gk940009 |
| h16851 |
| WBVar01574012 |
| gk115792 |
| ok2586 |
| gk115799 |
| gk115800 |
| gk115801 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00011232 | 7866136 | 7872100 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
276 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
| Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults. | Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05. | WBPaper00061530:nhr-49(e2144)_downregulated | |
| TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. | SAM | WBPaper00031040:TGF-beta_adult_upregulated | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Proteins detected in isolated mitochondria. | N.A. | WBPaper00067939:mitochondria_expressed_protein | |
| Transcripts that showed significantly decreased expression in eat-2(ad465) comparing to in N2. | DESeq2 1.30.1, fold change > 2, FDR < 0.05. | WBPaper00066890:eat-2(ad465)_downregulated | |
| Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq. | DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison. | WBPaper00045934:wrn-1(gk99)_upregulated | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. | edgeR, fold change > 2, FDR < 0.05 | WBPaper00060909:atfs-1(cmh15)_downregulated | |
| Transcripts that showed significantly decreased expression in daf-16(mu86);daf-18(ok480) comparing to in N2. | edgeR, fold change > 2, FDR < 0.05. | WBPaper00067999:daf-16(mu86);daf-18(ok480)_vs_N2_downregulated | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. | A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. | [cgc5767]:expression_class_SM | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day11_vs_Day1_downregulated | |
| Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). | Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. | WBPaper00040858:eQTL_regulated_reproductive | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts expressed in vulva. | FPKM >= 1. | WBPaper00064122:vulva_transcriptome | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. | DESeq2(v1.32.0), FDR < 0.05. | WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs |
17 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr4233 | The reporter gene that contains R11A5.4 promoter is expressed in C muscle cells. | |||
| Also expressed in (comments from author) : Mosaic population Strain: BC10543 | [R11A5.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GACTGGAGTCATTGGGTACGA] 3' and primer B 5' [CCGACTGTGCCGAAACTT] 3'. | Expr6502 | Adult Expression: intestine; Reproductive System; vulval muscle; spermatheca; Larval Expression: intestine; | |
| Expr2033013 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1034931 | Tiling arrays expression graphs | |||
| Expr1155424 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr2014779 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr15201 | In younger animals under standard growth conditions, the Is[Ppck-2 pck-2::gfp] translational fusion is expressed in the pharynx, in the intestine, in bodywall muscle, and in hypodermis. In adults, Is[Ppck-2 pck-2::gfp] expression becomes strikingly restricted to the very most anterior and posterior intestinal cells. | |||
| Expr15202 | We also note that, consistent with its assignment as a PEPCK-C ortholog, PCK-2::GFP appears localized to the cytoplasm in the cells in which it is expressed. | |||
| Expr15203 | We noted a striking difference in GFP expression between the functional PCK-2::GFP translational fusion and the Ppck-2 transcriptional reporter: while the PCK-2::GFP translational fusion is constitutively expressed, the pck-2 promoter-only transcriptional reporter is expressed solely in the intestine and only under food limitation conditions. | |||
| Expr1028959 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2041539 | Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690 | |||
| Curated by authors based on online in-situ hybridization database (Y. Kohara, personal communication; http://nematode.lab.nig.ac.jp). | Expr4049 | Broadly expressed in soma/embryo. | ||
| Expr15027 | PCK-2::YFP accumulated in the intestine, epidermis, body wall muscle, pharyngeal muscles, and sex muscles of both sexes; no neural expression was detectable. Expression of PCK-2 in the intestine and pharyngeal muscle is consistent with the earlier report that these tissues contain PEPCK activity (Yuan et al., 2016); however, in these tissues, the expression pattern suggests that the enzyme is likely expressed from pck-2, instead of the pck-1. | |||
| Original chronogram file: chronogram.505.xml | [R11A5.4:gfp] transcriptional fusion. | Chronogram1624 | ||
| Expr12929 | Transcripts encoding enzymes required for gluconeogenesis, mdh-1, mdh-2, and pck-2 were expressed at relatively high levels in dauer larvae. | |||
| Expr15028 | Subcellular analysis with a mitochondrial marker showed that PCK-2 has no association with mitochondria, but resides in the cytoplasm. | |||
| Original chronogram file: chronogram.18.xml | [R11A5.4:gfp] transcriptional fusion. | Chronogram761 |
21 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables |
10 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
21 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrI_7863570..7866135 | 2566 | I: 7863570-7866135 | Caenorhabditis elegans |
