WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00007384 Gene Name  swt-3
Sequence Name  ? C06G8.1 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable sugar transmembrane transporter activity. Predicted to be involved in carbohydrate transport. Predicted to be located in membrane. Expressed in Z1; Z4; and spermatheca. Is an ortholog of human SLC50A1 (solute carrier family 50 member 1). Biotype  SO:0001217
Genetic Position  IV :4.69651 ±0.001154 Length (nt)  ? 1699
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00007384

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C06G8.1.1 C06G8.1.1 1485   IV: 10778985-10780683
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C06G8.1 C06G8.1 1068   IV: 10779326-10779687

3 RNAi Result

WormBase ID
WBRNAi00039947
WBRNAi00010346
WBRNAi00028601

33 Allele

Public Name
gk964278
gk964078
gk964500
gk962765
gk963382
WBVar02021217
tm4973
h14938
gk211433
gk636842
gk211434
gk832238
gk211431
gk833472
gk211432
gk529229
gk211429
gk211430
WBVar01857399
gk317064
WBVar01857400
WBVar01730942
gk754450
gk483517
gk357370
gk536942
WBVar02058794
gk492194
ttTi39435
gk572858

1 Chromosome

WormBase ID Organism Length (nt)
IV Caenorhabditis elegans 17493829  

1 Chromosome Location


Feature . Primary Identifier 		Start End Strand
WBGene00007384 10778985 10780683 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_10777761..10778984   1224 IV: 10777761-10778984 Caenorhabditis elegans

281 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Transcripts that showed significantly decreased expression in eat-2(ad465) comparing to in N2. DESeq2 1.30.1, fold change > 2, FDR < 0.05. WBPaper00066890:eat-2(ad465)_downregulated
  Transcripts that showed significantly increased expression in eft-2(RNAi) animals at N2 background. DESeq2, fold change > 2 and p-value < 0.01. WBPaper00067953:eft-2(RNAi)_upregulated_N2
Starvation 48 hours at L1 arrest Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest) Fold change > 2. WBPaper00064005:starvation_upregulated_N2_mRNA
  Transcripts that showed significantly increased expression in eft-2(RNAi) animals at zip-2(tm4248) background. DESeq2, fold change > 2 and p-value < 0.01. WBPaper00067953:eft-2(RNAi)_upregulated_zip-2(tm4248)
Fungi infection: Myzocytiopsis humicola Transcripts that showed significantly altered expression 12 hours after animals were infected by M. humicola. Differentially expressed genes as determined by Kallisto and Sleuth (pval<0.01, qval<0.1). WBPaper00060871:M.humicola-infection_12h_regulated
  Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at N2 background. DESeq2, fold change > 2 and p-value < 0.01. WBPaper00067953:eif-2alpha(RNAi)_upregulated_N2
  Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at zip-2(tm4248) background. DESeq2, fold change > 2 and p-value < 0.01. WBPaper00067953:eif-2alpha(RNAi)_upregulated_zip-2(tm4248)
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts that showed significantly increased expression in hsf-1(sy441) vs. in N2 day 1 adults without heat shock. edgeR, fold change > 2, FDR < 0.05 WBPaper00066900:hsf-1(sy441)_upregulated
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Genes up regulated in alg-1(gk214) comparing to in N2. Differential expression was assessed using an empirical Bayes statistics using the eBayes function. WBPaper00040823:alg-1(gk214)_upregulated
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day11_vs_Day1_downregulated
mitochondrial sulfide delivery molecule (mtH2S) AP39 Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
Bacteria: Pseudomonas donghuensis HYS Transcripts that showed significantly increased expression after 24 hours of infection by Pseudomonas donghuensis HYS with deletion of ferric uptake regulator (FUR), comparing to control animals exposed to HYS. DESeq2, fold change > 2, FDR < 0.05. WBPaper00068216:FUR_vs_HYS_upregulated
Bacteria: Pseudomonas donghuensis HYS Transcripts that showed significantly increased expression after 24 hours of infection by Pseudomonas donghuensis HYS with deletion of ferric uptake regulator (FUR), comparing to control animals exposed to OP50. DESeq2, fold change > 2, FDR < 0.05. WBPaper00068216:FUR_vs_OP50_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). CuffDiff2 WBPaper00051265:F4_hrde-1(tm1200)_upregulated
  Transcripts that showed significantly increased expression in exos-8(RNAi) animals. fold change > 2, FDR < 0.05 WBPaper00068292:exos-8(RNAi)_upregulated
  Transcripts that showed significantly decreased expression in vit-2(ac3); zcIs4, comparing to parenting strain SJ4005 [zcIs4]. Differential gene expression analysis was then performed on normalized samples. Genes exhibiting at least twofold change and a false-discovery rate (FDR) of 1% or less were considered differentially expressed. WBPaper00051305:vit-2(ac3)_downregulated

9 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC11878 [C06G8.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGAGCGGGTGACTATTGAAA] 3' and primer B 5' [TGTTCAGAGAGTCGATTGTGCTA] 3'. Expr5194 Adult Expression: intestine; body wall muscle; hypodermis; Larval Expression: intestine; body wall muscle; hypodermis;  
    Expr2035301 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1033177 Tiling arrays expression graphs  
Strain UL1921, UL2561   Expr13580 Expression begins in late embryos in hypodermis. Faint bodywall muscle and hypodermal expression in larvae and adults, intestinal expression in larvae. Intestinal expression was seen in the adults previously. No embryonic expression was seen previously. Expression begins in late embryos in hypodermis. Faint bodywall muscle and hypodermal expression in larvae and adults, intestinal expression in larvae.  
    Expr13238 Stellaris smFISH probes targeting swt-3, an ortholog of the human solute carrier transporter SLC50A1, are shown in red (Cal Fluor 610), DAPI in blue, and PGL-1::GFP, a marker for P granules, in green. A) swt-3 transcripts are expressed in Z1/Z4 cells during embryogenesis (arrowheads). The embryo shows Z1 and Z4 migrating to Z2/Z3 P granule cells (marked with PGL-1::GFP in green). B) A dissected proximal gonad of a young adult capturing the ovulation of a recently fertilized zygote (arrow) as it passes through the swt-3 expressing spermatheca (red). Proximal oocyte marked with arrowhead. C) Sperm nuclei (blue) within the swt-3 (red) spermatheca. scale = 20um. The experiment confirms and extends swt-3 enrichment in cell-specific Z1/Z4 mRNA profiling experiment reported by Kroetz & Zarkower 2015.  
Original chronogram file: chronogram.1222.xml [C06G8.1:gfp] transcriptional fusion. Chronogram193    
    Expr1144021 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1028611 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2017165 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

12 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  located_in
  located_in
  located_in

2 Homologues

Type
orthologue
orthologue

1 Locations


Feature . Primary Identifier 		Start End Strand
WBGene00007384 10778985 10780683 -1

12 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  located_in
  located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1699

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_10780684..10785089   4406 IV: 10780684-10785089 Caenorhabditis elegans