WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00007103 Gene Name  crim-1
Sequence Name  ? B0024.14 Brief Description  crm-1 encodes a predicted transmembrane protein with multiple extracellular cysteine-rich (CR) domains that is the C. elegans ortholog of vertebrate CRIM1 (Cysteine-RIch Motor neuron 1); genetic analyses indicate that CRM-1 functions non-autonomously to positively regulate DBL-1/BMP-mediated signaling in the pathway that controls body size determination; in addition, loss of crm-1 activity via RNAi has been reported to result in animals that are sick, have molting defects, and show maternal sterility; a crm-1a::gfp reporter fusion is expressed in ventral cord neurons, neurons in the pharyngeal region, and male tail neurons, while a crm-1b::gfp reporter is seen in the pharynx and posterior intestine.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable serine-type endopeptidase inhibitor activity. Predicted to be located in extracellular region and membrane. Expressed in PVR; cholinergic neurons; and intestine. Is an ortholog of human CRIM1 (cysteine rich transmembrane BMP regulator 1).
Biotype  SO:0001217 Genetic Position  V :2.48874 ±0.005436
Length (nt)  ? 9830
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene is in one list:
metrics_list_union (10192)

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00007103

Genomics

6 Transcripts

Class WormMine ID Sequence Name Length (nt) Chromosome Location
MRNA Transcript:B0024.14a.1 B0024.14a.1 2992   V: 10322283-10329253
NcPrimaryTranscript Transcript:B0024.14c B0024.14c 2977   V: 10322288-10329250
NcPrimaryTranscript Transcript:B0024.14e B0024.14e 2457   V: 10322288-10329250
MRNA Transcript:B0024.14f.1 B0024.14f.1 2628   V: 10322569-10326443
MRNA Transcript:B0024.14d.1 B0024.14d.1 2715   V: 10322569-10329250
MRNA Transcript:B0024.14b.1 B0024.14b.1 2969   V: 10322569-10332112
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:B0024.14f B0024.14f 2628   V: 10322569-10322668
CDS:B0024.14d B0024.14d 2715   V: 10322569-10322668
CDS:B0024.14a B0024.14a 2703   V: 10322569-10322668
CDS:B0024.14b B0024.14b 2901   V: 10322569-10322668

11 RNAi Result

WormBase ID
WBRNAi00077094
WBRNAi00038649
WBRNAi00066766
WBRNAi00001794
WBRNAi00009549
WBRNAi00027943
WBRNAi00077096
WBRNAi00077095
WBRNAi00077098
WBRNAi00077097
WBRNAi00098922

139 Allele

Public Name
gk963301
gk963495
gk963496
WBVar02060723
WBVar02060724
WBVar02060725
WBVar02060726
WBVar02060727
gk964351
gk962860
gk964304
WBVar01864682
WBVar01864683
gk960795
gk962646
gk963569
WBVar01864679
WBVar01864677
WBVar01864678
WBVar01864680
WBVar01864681
WBVar01864686
WBVar01864687
WBVar01864684
WBVar01864685
WBVar01864688
WBVar01864689
WBVar01864690
WBVar01864691
WBVar01864675

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier 		Start End Strand
WBGene00007103 10322283 10332112 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

219 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
  Transcripts that showed significantly increased expression in pri-1(RNAi) animals comparing to in N2 animals fed with empty vector. Differential expression analysis was performed quasi-likelihood F-test with the generalized linear model (GLM) approach in edgeR ver 3.32.1. FDR < 0.05, fold change > 2. WBPaper00066418:pri-1(RNAi)_upregulated
Starvation 48 hours at L1 arrest Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest) Fold change > 2. WBPaper00064005:starvation_upregulated_N2_mRNA
  Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at N2 background. DESeq2, fold change > 2 and p-value < 0.01. WBPaper00067953:eif-2alpha(RNAi)_upregulated_N2
  Transcripts that showed significantly increased expression in hsf-1(sy441) vs. in N2 day 1 adults without heat shock. edgeR, fold change > 2, FDR < 0.05 WBPaper00066900:hsf-1(sy441)_upregulated
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
  Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in exos-8(RNAi) animals. fold change > 2, FDR < 0.05 WBPaper00068292:exos-8(RNAi)_upregulated
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. SAM algorithm with an FDR < 0.1. WBPaper00033065:clk-1(qm30)_upregulated
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
  Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage. DESeq2, fold change > 2 WBPaper00058725:sftb-1(cer6)_downregulated

11 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Picture: Fig. 3A, B, C, D.   Expr4902 In the transgenic animals carrying crm-1a::gfp reporter, consistent signals were detected in neurons in the ventral nerve cord. By the positions and clustering of the cell body as well as the axonal outgrowth along the ventral nerve cord, crm-1a is found to be expressed in the DA neurons 2 to 7, the DB neurons 3 to 7 and additional neurons in the VA, VB and AS classes along the nerve cord (VNC). Expression was also observed in neurons around the pharynx. In the male tail, gfp signals in the RnA neuronal cells of sensory rays 2 and 4 and the PVR neuron with the entire axonal process along the VNC were also observed. Entire axonal process of PVR along the VNC.
Picture: Fig. 3A, E, F.   Expr4903 crm-1b expression was active in the entire pharynx and posterior gut.  
Strain: BC10320 [B0024.14a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GACGGTCTCTCTGTTTCTCGTT] 3' and primer B 5' [CTAGTTGGATTCTCGAGCTGTAAA] 3'. Expr5011 Adult Expression: Reproductive System; vulval muscle; Nervous System; head neurons; tail neurons; Larval Expression: Nervous System; head neurons; tail neurons;  
Strain: BC13961 [crm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGAACTGGAAATGTGAATTGAAC] 3' and primer B 5' [CTTGACCACTGGATTTCAACAA] 3'. Expr5012 Adult Expression: pharynx; Reproductive System; vulval muscle; Larval Expression: pharynx;  
    Expr1033053 Tiling arrays expression graphs  
    Expr2010534 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1142856 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2028774 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1014928 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.2093.xml [B0024.14:gfp] transcriptional fusion. Chronogram1035    
Original chronogram file: chronogram.2153.xml [B0024.14:gfp] transcriptional fusion. Chronogram1089    

10 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables

4 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier 		Start End Strand
WBGene00007103 10322283 10332112 -1

10 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
9830

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00002804
WBStrain00001277

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_10332113..10332292   180 V: 10332113-10332292 Caenorhabditis elegans