Genomics
4 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:C26C6.1b.2 | C26C6.1b.2 |
5979
 |
I: 7495436-7503506 |
| Transcript:C26C6.1a.1 | C26C6.1a.1 |
6001
|
I: 7495437-7503577 |
| Transcript:C26C6.1b.3 | C26C6.1b.3 |
2603
|
I: 7499157-7503572 |
| Transcript:C26C6.1b.1 | C26C6.1b.1 |
1878
|
I: 7501317-7503506 |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:C26C6.1b | C26C6.1b |
1542
|
I: 7501380-7501727 |
| CDS:C26C6.1a | C26C6.1a |
5652
|
I: 7495442-7495567 |
26 RNAi Result
96 Allele
| Public Name |
|---|
| gk962858 |
| gk962706 |
| gk963902 |
| WBVar01432105 |
| tm415 |
| gk459730 |
| gk354182 |
| gk954223 |
| WBVar01500523 |
| gk612158 |
| gk450813 |
| os73 |
| gk484157 |
| gk628651 |
| gk748643 |
| gk355768 |
| st12226 |
| gk662478 |
| gk593703 |
| gk347664 |
| gk506877 |
| gk517162 |
| gk506878 |
| gk911041 |
| gk451794 |
| WBVar01909783 |
| WBVar01909784 |
| WBVar01909785 |
| WBVar01909782 |
| gk961919 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00007042 | 7495436 | 7503577 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
151 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Genes with expression altered >= 3-fold in dpy-10(e128) mutants. | Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). | WBPaper00035873:dpy-10_regulated | |
| Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. | Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. | DESeq2 fold change > 2, p-value < 0.01. | WBPaper00061007:S.aquatilis_downregulated |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Transcripts that showed significantly increased expression after 24-hour exposure to 10uM benzyl butyl phthalate (BBP) in col-121(nx3) animals. | DESeq2v1.38.3, FDR < 0.05 | WBPaper00067417:benzyl-butyl-phthalate_regulated | |
| 25C vs. 20C | Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C. | CuffDiff, fold change > 2. | WBPaper00065096:25C_vs_20C_upregulated |
| Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. | CuffDiff, fold change > 2. | WBPaper00065096:Day10_vs_Day1_upregulated | |
| Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. | The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. | WBPaper00065373:Cisplatin_downregulated_WT | |
| Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage. | DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. | WBPaper00066110:tetraploid_vs_diploid_downregulated | |
| Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:hypodermis_L3-L4-larva_expressed | |
| Transcripts that showed significantly increased expression in pry-1(mu38) animals comparing to in N2 at L1 larva stage. | DESeq, FDR < 0.05 | WBPaper00055626:pry-1(mu38)_upregulated | |
| Proteins interacting with HA-PPM-1.D. | N.A. | WBPaper00062498:PPM-1.D_interacting | |
| Bacteria: B.thuringiensis | Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. | Cuffdiff | WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi) |
| Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. | To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. | WBPaper00045521:Gender_Neutral |
13 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Strain: BC12725 | [C26C6.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGACAAATCTCATGGACAAAA] 3' and primer B 5' [TGATTGAGTCTGAAAACGGAAATA] 3'. | Expr5337 | Adult Expression: unidentified cells in head; unidentified cells in tail ; Larval Expression: Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; | |
| Strain: BC12726 | [C26C6.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGACAAATCTCATGGACAAAA] 3' and primer B 5' [TGATTGAGTCTGAAAACGGAAATA] 3'. | Expr5338 | Adult Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; vulva other; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; | |
| Expr1019832 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr1033021 | Tiling arrays expression graphs | |||
| Expr10407 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
| [PBRM-1::gfp] translational fusion. The pbrm-1::gfp construct consisted of a genomic fragment from a cosmid C09B10 (a 2-kb fragment from 1.5-kb upstream of the start codon to the XbaI site) and a PCR fragment (XbaI site to the codon that corresponds to the C-terminus of PBRM-1). which was amplified from the yk1173e11 cDNA clone (a gift from Y. Kohara, National Institute of Genetics, Mishima, Japan) and ligated to the gfp gene from pPD95.75 (a gift from A. Fire). | Expr9856 | PBRM-1::GFP was expressed in the nuclei of most, if not all, somatic cells, including the T cell and its daughter cells. PBRM-1::GFP was first observed during the gastrulation stage and continues to be expressed throughout subsequent development and in the adult stage. During mitosis, PBRM-1::GFP was associated with chromosomes in the T cell and in other seam cells. | ||
| Original chronogram file: chronogram.1522.xml | [C26C6.1:gfp] transcriptional fusion. | Chronogram507 | ||
| Expr2040360 | Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690 | |||
| Expr2014764 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1145288 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr11491 | PBRM-1::GFP was expressed ubiquitously and localized to nuclei throughout development. | |||
| Expr2032998 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Original chronogram file: chronogram.2143.xml | [C26C6.1:gfp] transcriptional fusion. | Chronogram1078 |
22 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| part_of | |
| part_of | |
| part_of | |
| enables | |
| enables | |
| enables |
8 Homologues
| Type |
|---|
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| orthologue |
| orthologue |
22 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| part_of | |
| part_of | |
| part_of | |
| enables | |
| enables | |
| enables |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrI_7494737..7495435 | 699 | I: 7494737-7495435 | Caenorhabditis elegans |
