Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:C17G1.6b.1 | C17G1.6b.1 |
2302
 |
X: 9944844-9949063 |
| Transcript:C17G1.6a.1 | C17G1.6a.1 |
2539
|
X: 9944844-9949060 |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:C17G1.6a | C17G1.6a |
2298
|
X: 9945084-9945146 |
| CDS:C17G1.6b | C17G1.6b |
2058
|
X: 9945084-9945146 |
69 Allele
| Public Name |
|---|
| gk964260 |
| gk962707 |
| WBVar02065808 |
| WBVar02065809 |
| gk964090 |
| WBVar02069054 |
| tm410 |
| gk951786 |
| gk951787 |
| WBVar02045206 |
| WBVar02116614 |
| gk290794 |
| gk290793 |
| gk290792 |
| WBVar01897855 |
| WBVar01897856 |
| gk290791 |
| WBVar01888149 |
| gk290790 |
| WBVar01888150 |
| gk290789 |
| ox190 |
| WBVar01888151 |
| ox197 |
| WBVar01888152 |
| ox196 |
| ox199 |
| WBVar01888147 |
| WBVar01888148 |
| gk290796 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00003553 | 9944844 | 9949063 | -1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
203 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
| Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00066485:ogt-1(ok1474)_upregulated_neuron | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_NoFood |
| Bacteria infection: Enterococcus faecalis | Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. | For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. | WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray |
| Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq. | DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison. | WBPaper00045934:wrn-1(gk99)_upregulated | |
| Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at N2 background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eif-2alpha(RNAi)_upregulated_N2 | |
| Transcripts that showed significantly increased expression in hsf-1(sy441) vs. in N2 day 1 adults without heat shock. | edgeR, fold change > 2, FDR < 0.05 | WBPaper00066900:hsf-1(sy441)_upregulated | |
| Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2. | DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1. | WBPaper00046012:tdp-1(ok803)_upregulated | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector. | p-value <= 0.05 | WBPaper00066902:cat-1(RNAi)_regulated | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. | edgeR, fold change > 2, FDR < 0.05 | WBPaper00060909:atfs-1(cmh15)_downregulated | |
| Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day5_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. | Fold change > 2. | WBPaper00064306:Agaro-oligosaccharides_upregulated | |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| starvation 12 hours | Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals. | EdgeR, FDR < 0.05, fold change >= 2. | WBPaper00067259:starvation_upregulated_intestine |
| Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_N2-background | |
| Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. | DESeq2 version 1.22.2, p < 0.05 | WBPaper00064716:paraquat_downregulated | |
| Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals. | NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%. | WBPaper00064727:daf-2(e1370)_upregulated | |
| Transcripts that showed signifcantly increased expression in ubr-5(miy31) injected with empty vector comparing to in N2 animals injected with empty vector at L1 larva stage and collected at L4 larva stage. | FDR < 0.05, fold change > 2 | WBPaper00067368:ubr-5(miy31)_upregulated_N2 | |
| Transcripts that showed significantly decreased expression in N2 day 2 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. | DESeq fold change > 2, FDR < 0.05. | WBPaper00067499:Day2_vs_Day1_downregulated_Illumina | |
| Transcripts that showed significantly decreased expression in N2 day 3 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. | DESeq fold change > 2, FDR < 0.05. | WBPaper00067499:Day3_vs_Day1_downregulated_Illumina | |
| Transcripts that showed significantly decreased expression in N2 day 4 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. | DESeq fold change > 2, FDR < 0.05. | WBPaper00067499:Day4_vs_Day1_downregulated_Illumina | |
| Transcripts that showed significantly decreased expression in N2 day 5 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. | DESeq fold change > 2, FDR < 0.05. | WBPaper00067499:Day5_vs_Day1_downregulated_Illumina | |
| Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. | DESeq | WBPaper00053302:stavudine_24h_regulated | |
| Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. | DESeq fold change > 2, FDR < 0.05. | WBPaper00067499:Day7_vs_Day1_downregulated_Illumina |
11 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Strain: BC13462 | [nas-37::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAATATTGTAGGAGGCAAGTCG] 3' and primer B 5' [TGCAAAATAGAACATCAAGAATCG] 3'. | Expr5287 | Adult Expression: rectal epithelium; Reproductive System; vulva other; seam cells; Larval Expression: rectal epithelium; hypodermis; seam cells; | |
| Expr3124 | Bright fluorescence was observed in the Hyp5 hypodermal cell at the anterior end of the larvae as well as at other attachment points of the cuticle at the anterior end of larvae, in the arcade cells in the mouth, the anterior pharynx and the amphid socket cells, and in the rectal epithelial cells at the posterior end of the larvae. Bright fluorescence was also observed in the hypodermal cells of each larval stage. Expression was not seen in the seam cells of L1 through L3 larvae; however, the seam cells of the L4 larvae strongly expressed nas-37::GFP. The L4 stage is when the seam cells terminally differentiate and fuse with the hypodermal syncytium. The expression in the hypodermis and seam cells disappeared in adult worms after a few hours. However, expression continued in the vulval epithelial cells and the rectal epithelial cells in the adult. | |||
| Picture: N.A. | Expr8931 | Expressed in all intestinal cells(weak), major hypodermis including seam cells (weak), rectal epithelial cells, vulval epithelium and rectal epithelium. | ||
| Expr3042 | In the nas-37p::gfp-transformed animals, GFP was observed to be expressed in the hypoderma cells except the seam cells and in the rectal gland cells throughout the larval stages. When the -879 to +5 region instead of the -3679 to +5 region of nas-37 was used, a faint fluorescence of GFP was detected in the hypodermal seam cells but not in the other hypodermal cells. Therefore, it is thought that a DNA motif(s) essential for expression is located in the -3679 to +879 region of the nas-37 gene. | |||
| Expr3126 | The NAS-37::GFP fusion protein was found in the cuticle, with high concentration in the anterior of the worm overlying Hyp5. It was also concentrated in the alae, vulval cuticle and cuticle of the rectum. In addition, the protein was abundantly expressed in the excretory duct cell. The protein began to appear in the anterior cuticle 4 hours before each molt, consistent with the transcriptional GFP fusion results (see Expr3124 and Expr3125). Despite high levels of transcription of nas-37 in hypodermal cells, high levels of protein accumulation were not observed in these cells. GFP fluorescence was also observed in shed cuticles, demonstrating that the fusion protein is indeed secreted and deposited into the old cuticle. | |||
| Expr3125 | To test whether peak NAS-37 expression coincided with ecdysis in each larval stage, a PEST protein degradation signal was fused onto the C-terminus of the pWD90 GFP construct. This sequence increases protein turnover and should rapidly eliminate GFP fluorescence after expression has stopped. As expected, bright fluorescence was observed in the Hyp5 cell at the anterior tip of the animal and in the rectal epithelial cells at ecdysis. After the molt, nas-37 expression was very low in all cells, although expression continued in Hyp5 and the rectal epithelial cells. GFP expression driven by the nas-37 promoter (Pnas-37::GPF) began to rise about 6 hours before ecdysis, with peak nas-37 expression in hypodermal cells (and seam cells exclusively in the L4 stage) about 4 hours before each molt. | |||
| Expr3691 | Fluorescence was observed in epithelial cells that synthesize cuticle. Expressed in the hypodermis, including the major body syncytium, hyp7, and hypodermal cells in the head and tail. Also expressed in the lateral seam cells. Fluorescence from nas-37p::gfp-pest in seam cells was observed only before the L4 stage-to-adult molt, when the cells terminally differentiate and fuse. A pulse of fluorescence was observed in the hypodermis prior to molting. Expression of nas-37p::gfp-pest also cycled in phase with all four molts. Expression of the gfp fusion genes was never detected in the hypodermis of gravid adults that no longer molt. | |||
| Expr1020217 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2013883 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1144876 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr2032123 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). |
20 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| enables | |
| enables | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables |
21 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
20 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| enables | |
| enables | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrX_9949064..9950352 | 1289 | X: 9949064-9950352 | Caenorhabditis elegans |
