Genomics
17 Transcripts
Other
17 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F14D12.4d | F14D12.4d |
3543
 |
X: 5573152-5573296 |
| CDS:F14D12.4k | F14D12.4k |
1002
|
X: 5573152-5573296 |
| CDS:F14D12.4h | F14D12.4h |
1269
|
X: 5573152-5573296 |
| CDS:F14D12.4m | F14D12.4m |
1323
|
X: 5573152-5573296 |
| CDS:F14D12.4b | F14D12.4b |
1179
|
X: 5575969-5576190 |
| CDS:F14D12.4o | F14D12.4o |
1299
|
X: 5579594-5579714 |
| CDS:F14D12.4i | F14D12.4i |
1245
|
X: 5579594-5579714 |
| CDS:F14D12.4g | F14D12.4g |
3495
|
X: 5582674-5582770 |
| CDS:F14D12.4a | F14D12.4a |
1446
|
X: 5575969-5576190 |
| CDS:F14D12.4c | F14D12.4c |
954
|
X: 5582674-5582770 |
| CDS:F14D12.4e | F14D12.4e |
3720
|
X: 5575969-5576190 |
| CDS:F14D12.4f | F14D12.4f |
3519
|
X: 5579594-5579714 |
| CDS:F14D12.4j | F14D12.4j |
1221
|
X: 5582674-5582770 |
| CDS:F14D12.4l | F14D12.4l |
978
|
X: 5579594-5579714 |
| CDS:F14D12.4n | F14D12.4n |
1500
|
X: 5575969-5576190 |
| CDS:F14D12.4p | F14D12.4p |
1275
|
X: 5582674-5582770 |
| CDS:F14D12.4q | F14D12.4q |
1200
|
X: 5567754-5567829 |
374 Allele
| Public Name |
|---|
| gk964260 |
| WBVar02063872 |
| WBVar02063874 |
| WBVar02063873 |
| WBVar02063876 |
| WBVar02063875 |
| WBVar02063878 |
| WBVar02063877 |
| WBVar02063879 |
| WBVar01758458 |
| WBVar01758459 |
| WBVar01758461 |
| WBVar01758460 |
| WBVar01758463 |
| WBVar01758462 |
| gk3126 |
| gk280862 |
| WBVar01601772 |
| WBVar01601771 |
| WBVar01601773 |
| WBVar00079228 |
| WBVar00079227 |
| WBVar00079229 |
| WBVar00079224 |
| WBVar00079223 |
| WBVar00079226 |
| WBVar00079225 |
| WBVar00079231 |
| WBVar00079209 |
| WBVar00079211 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00003166 | 5567754 | 5590830 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrX_5590831..5593132 | 2302 | X: 5590831-5593132 | Caenorhabditis elegans |
181 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
| Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. | SAM | WBPaper00031040:TGF-beta_adult_upregulated | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. | DESEQ2, fold change > 2 and FDR < 0.01. | WBPaper00062103:neuron_enriched | |
| Genome-wide analysis of developmental and sex-regulated gene expression profile. | self-organizing map | cgc4489_group_18 | |
| Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at N2 background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eif-2alpha(RNAi)_upregulated_N2 | |
| Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at zip-2(tm4248) background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eif-2alpha(RNAi)_upregulated_zip-2(tm4248) | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141) | |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
| Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. | Fold change > 2. | WBPaper00064306:Agaro-oligosaccharides_upregulated | |
| Transcripts that showed significantly increased expression in exos-8(RNAi) animals. | fold change > 2, FDR < 0.05 | WBPaper00068292:exos-8(RNAi)_upregulated | |
| starvation 12 hours | Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals. | EdgeR, FDR < 0.05, fold change >= 2. | WBPaper00067259:starvation_upregulated_intestine |
| Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background | |
| Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_N2-background | |
| Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. | DESeq | WBPaper00053302:stavudine_24h_regulated | |
| Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated | |
| Genes with increased RNA expression after 24 hours rotenone treatment | EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed. | WBPaper00044426:rotenone_24h_upregulated | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:A-class-motor-neurons_L2-larva_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:all-neurons_L2-larva_expressed | |
| Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:daf-2(e1370)_upregulated | |
| Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed | |
| Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2. | DESeq 2, fold change > 2, FDR < 0.05. | WBPaper00065581:hpk-1(pk1393)_upregulated |
18 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr1031501 | Tiling arrays expression graphs | |||
| Strain: BC14009 | [mec-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAGCATTATCAGCAGCGTC] 3' and primer B 5' [AATGTGTGGGCATTCAGTCA] 3'. | Expr5756 | Adult Expression: Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; head neurons; neurons along body; tail neurons; | |
| Expr16015 | The mec-2B (short) translational reporter revealed expression in touch neurons as well as many additional neurons in the head and tail. This corroborates our RNA-seq observations that the non-canonical short mec-2B isoform is the predominant form of mec-2 expressed in wild-type animals, with expression in both touch neurons and additional neuron types. To test whether the short mec-2B isoform is expressed in specific amphid neurons, we labeled the amphid AWB and AWC olfactory neurons with an odr- 1p::RFP reporter. MEC-2B::GFP expression is clearly visible in both AWB and AWC neuronal cell bodies, as well as their axons and dendrites. | |||
| Expr16016 | Endogenously-tagged short mec-2B isoform is also detectable in touch neurons, with a similar punctate expression. In agreement with our transgenic MEC-2B::GFP overexpression results, we find endogenous short isoform MEC-2B::RFP expressed abundantly in many head and tail neurons in addition to touch neurons. | |||
| Expr1557 | Beta-gal activity was seen in the six touch receptor neurons and a few other cells, particularly in the head. GFP was seen in the same cells, although fluorescence was higher in the six touch receptor neurons than in the other cells. | |||
| No GO_term assigned. | Expr3306 | These antibodies bound exclusively to the six touch receptor neurons in a punctate pattern that depended on the presence of MEC-2. | Expressed in the six touch receptor neurons in a punctate pattern. | |
| Expr3307 | Previously, mec-2 beta-galactosidase and GFP reporters driven by 2.5 kb of upstream promoter sequence were expressed in the six touch receptor neurons plus additional neurons in the head and tail (see Expr1557). This additional expression was confirmed. | |||
| Expr3308 | GFP was only expressed in the touch receptor neurons. | |||
| Picture: Fig 3, S1, Supplementary Video 1 | Expr8329 | Anti-MEC-4 and anti-MEC-2 antibodies decorated two structures in wild-type TRNs, the plasma membrane and the 15pf microtubules, whereas anti-MEC-5 antibodies decorated the space in between TRN neurites and the surrounding hypodermal cell. Approximately half of the MeT channel labels were associated with the plasma membrane: 51% (n = 49) and 44% (n = 36) of anti-MEC-2 and anti-MEC-4 labels, respectively). These labels were distributed around the circumference of the TRN neurite without any obvious bias for either the apical or basal aspect of the neurite. In some cases, clusters of gold labels were associated with the plasma membrane. Half of the membrane-associated anti-MEC-4 labels were doublets, whereas approximately one-fifth of the membrane-associated anti-MEC-2 labels contained clusters of 2 or 3 gold beads. Anti-MEC-5 antibodies were significantly more likely to be found on the apical side of TRN neurites. The remaining MeT channel labels were associated with 15pf microtubules distributed throughout the cytoplasm. Intracellular labels were not associated with vesicles in TRN neurites and vesicles were not detected in any of the five SS-IEM reconstructions, which covered a total length of 63 um. | ||
| Picture: Fig 1, Fig 2. | Expr8328 | All three antibodies labeled TRN cell bodies and discrete puncta along the length of TRN neurites. MEC-2 and MEC-4 interpunctum intervals had similar distributions, including a significant proportion of intervals that were longer than 2 um. The distribution of MEC-5 intervals was more compact and no interval was longer than 2 um. On average, MEC-2 and MEC-4 IF puncta were separated by 2.6 +/-2.7 um (n = 498 intervals) and 1.7 +/- 1.9 m (n = 386 intervals), respectively, whereas MEC-5 IF puncta were separated by only 0.65 +/- 0.6 m (n = 421 intervals). Double-labeling experiments revealed that, whereas MEC-2 and MEC-4 IF puncta were colocalized, MEC-2 and MEC-5 IF puncta frequently occupied distinct domains of lateral neurites. Samples colabeled with polyclonal antibodies raised against MEC-2 in mouse and rabbit served as a control for the values expected for colocalized proteins. This analysis strongly supports the conclusion that MEC-2 colocalizes with MEC-4 but not with MEC-5. | ||
| Expr16014 | The transcriptional reporter recapitulated the canonical expression pattern of mec-2, with expression restricted to touch neurons. | |||
| Expr16017 | Tagging the canonical long mec-2A isoform with RFP revealed strong expression in the touch neurons, with puncta visible in both the cell body and throughout the neurite, in accordance with previous imaging using antibody staining. | |||
| Expr16018 | The extra-long MEC-2E::RFP is expressed specifically in touch neurons. Similar to the long MEC-2A isoform, the extra-long MEC-2E isoform is expressed in a punctate pattern in both the cell bodies and the neurites of the touch neurons, and this expression is abolished in mec-8 mutants. Unlike the short MEC-2B isoform, there is no detectable expression of extra-long MEC-2E in head neurons. | |||
| Expr2013496 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1022251 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2031730 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1148542 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr3115 | Authors expressed NZGFP from the unc-24 promoter and CZGFP from the mec-2 promoter. The unc-24 promoter is expressed in the C. elegans touch receptor neurons and in many cells in the ventral cord; the mec-2 promoter is expressed in the six touch receptor neurons. recGFP was formed only in the six touch receptor neurons. |
28 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| located_in | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in |
15 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
28 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| located_in | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrX_5567320..5567753 | 434 | X: 5567320-5567753 | Caenorhabditis elegans |
