Genomics
3 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:F43E2.8a.2 | F43E2.8a.2 |
2232
 |
II: 7350112-7352645 |
| Transcript:F43E2.8a.1 | F43E2.8a.1 |
2159
|
II: 7350119-7352518 |
| Transcript:F43E2.8b.1 | F43E2.8b.1 |
975
|
II: 7350260-7351329 |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F43E2.8a | F43E2.8a |
1974
|
II: 7350260-7350364 |
| CDS:F43E2.8b | F43E2.8b |
975
|
II: 7350260-7350364 |
29 RNAi Result
28 Allele
| Public Name |
|---|
| gk963801 |
| gk963053 |
| gk962682 |
| gk963823 |
| gk815954 |
| gk614266 |
| gk641850 |
| gk871361 |
| gk450542 |
| gk594296 |
| gk386799 |
| gk723373 |
| gk766110 |
| gk547349 |
| gk605553 |
| gk415577 |
| gk728433 |
| gk578128 |
| tm10810 |
| tm10600 |
| gk146775 |
| WBVar00173327 |
| gk146772 |
| gk146774 |
| cxTi10614 |
| gk146773 |
| gk514 |
| WBVar01902577 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00002008 | 7350112 | 7352645 | -1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrII_7349134..7350111 | 978 | II: 7349134-7350111 | Caenorhabditis elegans |
265 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Genes that were downregulated in lin-15B(n744). | For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. | WBPaper00038168:lin-15B(n744)_downregulated | |
| Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). | DESeq2, fold change >= 2, FDR <= 0.01. | WBPaper00056826:SGP_biased | |
| Transcripts that showed significantly increased expression in pri-1(RNAi) animals comparing to in N2 animals fed with empty vector. | Differential expression analysis was performed quasi-likelihood F-test with the generalized linear model (GLM) approach in edgeR ver 3.32.1. FDR < 0.05, fold change > 2. | WBPaper00066418:pri-1(RNAi)_upregulated | |
| Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. | Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. | Cuffcompare and Cuffdiff | WBPaper00056090:E.faecalis_downregulated_N2 |
| Proteins detected in isolated mitochondria. | N.A. | WBPaper00067939:mitochondria_expressed_protein | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Heat shock: 35C for 1 hour. | Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite endu-2(tm4977) animals were exposed to 35C for 1 hour. | The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01. | WBPaper00065749:Heat-Shock_upregulated_endu-2(tm4977) |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. | A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. | [cgc5767]:expression_class_SM | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_age_regulated_developing | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_regulated_developing | |
| Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). | Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. | WBPaper00040858:eQTL_regulated_reproductive | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20) | |
| Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20) | |
| Transcripts expressed in vulva. | FPKM >= 1. | WBPaper00064122:vulva_transcriptome | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed |
18 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr1031172 | Tiling arrays expression graphs | |||
| Strain: BC11945 | [hsp-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTATTCACGTGTATCTTCTCCGA] 3' and primer B 5' [GATATTTTTCTCTTGATGAGCGGT] 3'. | Expr6061 | Adult Expression: intestine; Reproductive System; spermatheca; seam cells; Larval Expression: intestine; distal tip cell; developing spermatheca; hypodermis; seam cells; | |
| Expr1151063 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Picture: Figs. 3 and 4A. | Expr8168 | The worms incubated at 12 centigrades had little activation of HSP-4 protein as evidenced by minimal expression of GFP. On the contrary, worms incubated at 25 centigrades expressed high levels of GFP, more so towards the latter part of their lifetime. The thermocycled worms (at 10-min intervals between 12 centigrades and 25 centigrades) also expressed high levels of GFP, approximating levels of the worms incubated at 25 centigrades and at significantly higher levels than the worms incubated at 12 centigrades. The time needed for significant HSP-4 induction was greater than 12 h, as animals that were thermocycled for 12 h had GFP levels only 1.2 higher than those held at 12 centigrades. Therefore, GFP levels were measured at 3-day intervals at first, and followed by 6-day intervals. As indicated by the relatively small standard error bars, there was relatively little variation from animal to animal for each treatment. | ||
| Expr11240 | ||||
| Expr15767 | ||||
| Expr3927 | Expressed in the postmitotic intestinal cells during development and adulthood, | |||
| Expr14286 | We observed that phsp-4::GFP reporter was visibly induced in seam cells during two developmental stages -weakly in the late L4 stage and strongly in L2 stage animals on starved crowded plates- while it was undetectable in other larval stages. Closer examination suggested that hsp-4 expression is indeed induced in the posterior daughter cells, fated to differentiate into alae-secreting cells after the last asymmetric division. | |||
| Expr13430 | During L4 lethargus, hsp-4 was notably expressed in the epithelial seam of undisrupted animals. We observed that hsp-4 expression in seam cells coincided with the generation of the alae - the adult cuticular ridges. | |||
| Expr11091 | An hsp-4::gfp transcriptional reporter had relatively low basal green fluorescent protein (GFP) expression, most prominent in the spermatheca. | |||
| Expr12325 | HSP-4::GFP was exclusively localized in the PVD soma, colocalizing with a rough ER marker TRAM, HSP-4's endoplasmic reticulum localization pattern is consistent with the observation that its mammalian homolog BiP is localized in rough endoplasmic reticulum. | |||
| Expr1024535 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2012627 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr2041779 | Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690 | |||
| Original chronogram file: chronogram.2613.xml | [F43E2.8:gfp] transcriptional fusion. | Chronogram1370 | ||
| Expr11757 | Phsp-4::GFP is very weakly expressed in wild-type animals. | |||
| Original chronogram file: chronogram.2066.xml | [F43E2.8:gfp] transcriptional fusion. | Chronogram1008 | ||
| Expr2030863 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). |
26 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| located_in | |
| involved_in | |
| involved_in | |
| part_of | |
| part_of | |
| located_in | |
| located_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables |
26 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| located_in | |
| involved_in | |
| involved_in | |
| part_of | |
| part_of | |
| located_in | |
| located_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables |
4 Regulates Expr Cluster
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in fic-1(n5823);hsp-4(RNAi) comparing to fic-1(n5823) animals with control vector. | edgeR (v3.19, Bioconductor), p < 0.05, log2FC > 1.5 or < -1.5 | WBPaper00068266:hsp-4(RNAi)_downregulated_fic-1(n5823) | |
| Transcripts that showed significantly decreased expression in hsp-4(RNAi) comparing to N2 animals with control vector. | edgeR (v3.19, Bioconductor), p < 0.05, log2FC > 1.5 or < -1.5 | WBPaper00068266:hsp-4(RNAi)_downregulated_N2 | |
| Transcripts that showed significantly increased expression in hsp-4(RNAi) comparing to N2 animals with control vector. | edgeR (v3.19, Bioconductor), p < 0.05, log2FC > 1.5 or < -1.5 | WBPaper00068266:hsp-4(RNAi)_upregulated_N2 | |
| Transcripts that showed significantly increased expression in fic-1(n5823);hsp-4(RNAi) comparing to fic-1(n5823) animals with control vector. | edgeR (v3.19, Bioconductor), p < 0.05, log2FC > 1.5 or < -1.5 | WBPaper00068266:hsp-4(RNAi)_upregulated_fic-1(n5823) |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrII_7352646..7353575 | 930 | II: 7352646-7353575 | Caenorhabditis elegans |
