Genomics
3 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:C15H9.6a.2 | C15H9.6a.2 |
2666
 |
X: 6089028-6092124 |
| Transcript:C15H9.6a.1 | C15H9.6a.1 |
2366
|
X: 6089033-6091785 |
| Transcript:C15H9.6b.1 | C15H9.6b.1 |
978
|
X: 6089391-6090471 |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:C15H9.6b | C15H9.6b |
978
|
X: 6089391-6089969 |
| CDS:C15H9.6a | C15H9.6a |
1986
|
X: 6089391-6089969 |
34 RNAi Result
57 Allele
| Public Name |
|---|
| gk964260 |
| gk600238 |
| gk841416 |
| gk748495 |
| gk383800 |
| gk550021 |
| gk739313 |
| gk614080 |
| gk727017 |
| gk931234 |
| gk750957 |
| gk603222 |
| gk857720 |
| gk603751 |
| gk387984 |
| gk862991 |
| gk360413 |
| gk374569 |
| gk489866 |
| gk407825 |
| gk425088 |
| gk527346 |
| gk591945 |
| gk835265 |
| gk354031 |
| gk931834 |
| gk931835 |
| gk379482 |
| gk579210 |
| gk924547 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00002007 | 6089028 | 6092124 | -1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrX_6088413..6089027 | 615 | X: 6088413-6089027 | Caenorhabditis elegans |
273 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_NoFood |
| Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Psora-Allantoin_upregulated | |
| Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rapamycin-Metformin_upregulated | |
| Proteins detected in isolated mitochondria. | N.A. | WBPaper00067939:mitochondria_expressed_protein | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. | edgeR, fold change > 2, FDR < 0.05 | WBPaper00060909:atfs-1(cmh15)_downregulated | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Transcripts expressed in vulva. | FPKM >= 1. | WBPaper00064122:vulva_transcriptome | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. | DESeq2(v1.32.0), FDR < 0.05. | WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs | |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| Bacteria infection: Staphylococcus aureus | Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen. | DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. | WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated |
| Bacteria infection: Staphylococcus aureus | Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen. | DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. | WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated |
| Expression Pattern Group C, enriched for genes involved in metabolic processes. | The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05. | WBPaper00036286:Pattern_C |
12 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Also expressed in (comments from author) : Intestinal expression is mosaic. Strain: BC10066 | [hsp-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCAACAAACGAATAATAG] 3' and primer B 5' [tttgtgtttgatttattttcctg] 3'. | Expr5272 | Adult Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; coelomocytes; Nervous System; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; Nervous System; head neurons; tail neurons; unidentified cells in tail ; | |
| Expr1031171 | Tiling arrays expression graphs | |||
| Expr11242 | ||||
| Expr15768 | ||||
| Curated by authors based on online in-situ hybridization database (Y. Kohara, personal communication; http://nematode.lab.nig.ac.jp). | Expr4052 | Broadly expressed in soma/germline? | ||
| Expr10338 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
| Expr1023047 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2012625 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr2041005 | Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690 | |||
| Original chronogram file: chronogram.2324.xml | [C15H9.6:gfp] transcriptional fusion. | Chronogram1201 | ||
| Expr2030861 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1144691 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 |
24 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| part_of | |
| part_of | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables |
6 Homologues
| Type |
|---|
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
24 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| part_of | |
| part_of | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables |
4 Regulates Expr Cluster
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in hsp-3(RNAi) comparing to N2 animals with control vector. | edgeR (v3.19, Bioconductor), p < 0.05, log2FC > 1.5 or < -1.5 | WBPaper00068266:hsp-3(RNAi)_upregulated_N2 | |
| Transcripts that showed significantly decreased expression in hsp-3(RNAi) comparing to N2 animals with control vector. | edgeR (v3.19, Bioconductor), p < 0.05, log2FC > 1.5 or < -1.5 | WBPaper00068266:hsp-3(RNAi)_downregulated_N2 | |
| Transcripts that showed significantly decreased expression in fic-1(n5823);hsp-3(RNAi) comparing to fic-1(n5823) animals with control vector. | edgeR (v3.19, Bioconductor), p < 0.05, log2FC > 1.5 or < -1.5 | WBPaper00068266:hsp-3(RNAi)_downregulated_fic-1(n5823) | |
| Transcripts that showed significantly increased expression in fic-1(n5823);hsp-3(RNAi) comparing to fic-1(n5823) animals with control vector. | edgeR (v3.19, Bioconductor), p < 0.05, log2FC > 1.5 or < -1.5 | WBPaper00068266:hsp-3(RNAi)_upregulated_fic-1(n5823) |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrX_6092125..6093299 | 1175 | X: 6092125-6093299 | Caenorhabditis elegans |
