Genomics
6 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:F15G9.4b.1 | F15G9.4b.1 |
15853
 |
X: 9717565-9753764 |
| Transcript:F15G9.4d.1 | F15G9.4d.1 |
12156
|
X: 9717626-9747066 |
| Transcript:F15G9.4a.1 | F15G9.4a.1 |
15720
|
X: 9717626-9753761 |
| Transcript:F15G9.4e.1 | F15G9.4e.1 |
15303
|
X: 9718417-9753569 |
| Transcript:F15G9.4f.1 | F15G9.4f.1 |
15234
|
X: 9718417-9753569 |
| Transcript:F15G9.4c.1 | F15G9.4c.1 |
639
|
X: 9752701-9753569 |
Other
6 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F15G9.4a | F15G9.4a |
15528
|
X: 9717626-9717878 |
| CDS:F15G9.4e | F15G9.4e |
15303
|
X: 9718417-9718480 |
| CDS:F15G9.4f | F15G9.4f |
15234
|
X: 9718417-9718480 |
| CDS:F15G9.4c | F15G9.4c |
639
|
X: 9752701-9752842 |
| CDS:F15G9.4b | F15G9.4b |
15597
|
X: 9717626-9717878 |
| CDS:F15G9.4d | F15G9.4d |
11889
|
X: 9717626-9717878 |
23 RNAi Result
577 Allele
| Public Name |
|---|
| gk964260 |
| gk962707 |
| WBVar01927993 |
| WBVar01927994 |
| gk964126 |
| gk615221 |
| gk677785 |
| gk964352 |
| ttTi1223 |
| gk964353 |
| gk434855 |
| WBVar01758955 |
| WBVar01758954 |
| WBVar01758957 |
| WBVar01758956 |
| WBVar01758959 |
| WBVar01758958 |
| WBVar01758960 |
| WBVar01758962 |
| WBVar01758961 |
| WBVar01758963 |
| rh166 |
| rh306 |
| rh321 |
| rh319 |
| WBVar01693669 |
| WBVar02065741 |
| WBVar02065742 |
| WBVar02065745 |
| WBVar02065746 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00001863 | 9717565 | 9753764 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrX_9753765..9754601 | 837 | X: 9753765-9754601 | Caenorhabditis elegans |
253 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Genes with expression altered >= 3-fold in dpy-10(e128) mutants. | Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). | WBPaper00035873:dpy-10_regulated | |
| Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. | SAM | WBPaper00031040:TGF-beta_adult_upregulated | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:bodywall-muscle_L1-larva_expressed | |
| Genes that were upregulated in lin-15B(n744). | For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. | WBPaper00038168:lin-15B(n744)_upregulated | |
| Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. | Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. | Cuffcompare and Cuffdiff | WBPaper00056090:E.faecalis_downregulated_N2 |
| Transcripts that showed significantly decreased expression in eat-2(ad465) comparing to in N2. | DESeq2 1.30.1, fold change > 2, FDR < 0.05. | WBPaper00066890:eat-2(ad465)_downregulated | |
| Transcripts that showed significantly increased expression in eft-2(RNAi) animals at N2 background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eft-2(RNAi)_upregulated_N2 | |
| Starvation 48 hours at L1 arrest | Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest) | Fold change > 2. | WBPaper00064005:starvation_upregulated_N2_mRNA |
| Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at N2 background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eif-2alpha(RNAi)_upregulated_N2 | |
| Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at zip-2(tm4248) background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eif-2alpha(RNAi)_upregulated_zip-2(tm4248) | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Heat shock: 35C for 1 hour. | Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite N2 animals were exposed to 35C for 1 hour. | The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01. | WBPaper00065749:Heat-Shock_upregulated_N2 |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day5_vs_Day1_downregulated | |
| Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_age_regulated_aging | |
| Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_age_regulated_developing | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day11_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141) | |
| Bacteria: Pseudomonas donghuensis HYS | Transcripts that showed significantly increased expression after 24 hours of infection by Pseudomonas donghuensis HYS with deletion of ferric uptake regulator (FUR), comparing to control animals exposed to OP50. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00068216:FUR_vs_OP50_upregulated |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated |
12 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr1031096 | Tiling arrays expression graphs | |||
| Strain: BC13149 | [him-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACAACGGAATGCCTGAAAAC] 3' and primer B 5' [GACTCCGTCCGATTTTTGAA] 3'. | Expr5771 | Adult Expression: body wall muscle; Larval Expression: body wall muscle; | |
| Expr1019567 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr15292 | As expected, localization of mkate2::HIM-4 to the pharyngeal basement membrane was observed at the L1 stage. In contrast to the uniform localization on the basement membrane of type IV collagen or nidogen, which are major components of the basement membrane, that of mkate2::HIM-4 was polarized at the anterior part of the pharyngeal basement membrane. A unique polarized localization pattern was also observed in the pharyngeal basement membrane at stage L4. These observations indicate that polarized HIM-4 localization in the anterior part of the pharyngeal BM is maintained throughout the L1-L4 stages. The localization was also observed at the rachis during gonadal development at the L4 stage; this observation was consistent with that of previous reports. | |||
| Refer to Birchall,Fishpool & Albertson (1995) life_stage summary : postembryonic | Expr2 | Post-embryonic expression. punctate signal body muscle | ||
| BWMs expressing DsRed2 driven from the muscle-specific C26G2.1 promoter showed no differences from Mb::YFP in arm morphology or the number of arms observed with the two different reporters. Therefore Mb::YFP driven from him-4p does not interfere with muscle arm number or morphology and is a useful tool to study muscle membrane extension. Picture: Figure 1D, 1E, 2A | Marker8 | Expressed in only a subset of distal body wall muscles(BWM) and therefore enables the clear visualization of individual muscle arms. Expression of Mb::YFP from him-4p in first larval-stage (L1) larvae was limited to four distal BMWs posterior to the neck muscles in each quadrant. As development continued, two more distal BWMs posterior to the initial four in each quadrant also expressed Mb::YFP, albeit at lower levels. | muscle arms | |
| Expr879 | Excepting body wall muscles and gonadal leaders, described below, no other cells were observed to express SP-GFP-hemicentin. Body wall muscles: Beginning in late embryogenesis (approx. 500 minutes), and continuing through adulthood, hemicentin is synthesized by lateral body wall muscle cells along the entire length of the animal, excepting cells six and eight near the nerve ring. Medial body wall muscle cells express little if any hemicentin. Gonadal leaders (hermaphrodite): Beginning soon after their genesis in late L1 stage, hermaphrodite distal-tip cells express hemicentin continuously throughout development. The anchor cell, or proximal leader, expresses hemicentin beginning in early L3 stage soon after cell commitment. SP-GFP-hemicentin diffuses throughout the utse syncytium at this time, but it is not known whether him-4 is transcribed in nuclei other than the anchor. In the adult, all expression within the utse syncytium ceases. Gonadal leaders (male): In the male, distal-tip cells never express hemicentin. The linker cell, or proximal leader, expresses hemicentin beginning at early L2 stage. | |||
| Expr2030665 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr12100 | Hemicentin was deposited at low levels throughout the ventral and gonadal basal membranes (BMs), and accumulated in track-like lines at the edges of the ventral BM. Notably, prior to invasion (from P6.p one-cell stage to mid P6.p two-cell stage), hemicentin accumulated in punctae precisely under the AC. The approximate size of the hemicentin structures was similar to the size of the BM-BM adhesions observed with electron microscopy (187.2 ± 0.8 nm, n = 104 structures in 23 worms). Time-lapse imaging revealed that hemicentin structures were static and new punctae continued to form throughout the course of AC invasion. Once formed, the hemicentin structures remained within the BM under the AC and did not disassemble during invasion (n = 132 punctae in 22 animals). Hemicentin punctae are tightly associated with the BM and are present at the time and location of BM-BM adherence. | |||
| Expr1148719 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr2012429 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr11540 | Hemicentin assembles at the cleavage furrow of C.elegans germ cells. Hemicentin::GFP concentrates in a ring around incomplete cleavage furrows in germ cell plasma membranes. |
18 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| located_in | |
| located_in | |
| involved_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| adjacent_to(WBbt:0008125) | located_in |
| located_in | |
| located_in |
26 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
18 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| located_in | |
| located_in | |
| involved_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| adjacent_to(WBbt:0008125) | located_in |
| located_in | |
| located_in |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrX_9713714..9717564 | 3851 | X: 9713714-9717564 | Caenorhabditis elegans |
