Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:C34E10.6.1 | C34E10.6.1 |
1929
 |
III: 5228417-5230536 |
| Transcript:C34E10.6.2 | C34E10.6.2 |
1846
|
III: 5228417-5230532 |
Other
1 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:C34E10.6 | C34E10.6 |
1617
|
III: 5228428-5228518 |
66 RNAi Result
29 Allele
| Public Name |
|---|
| WBVar01607038 |
| gk446075 |
| WBVar01893346 |
| gk174288 |
| gk174287 |
| gk174290 |
| gk174289 |
| ok3002 |
| gk174286 |
| ua2 |
| gk724836 |
| gk568286 |
| gk399701 |
| gk344533 |
| gk487526 |
| gk568285 |
| gk317632 |
| gk713146 |
| gk887173 |
| gk474638 |
| WBVar00056221 |
| WBVar01995189 |
| h13731 |
| gk958851 |
| gk958852 |
| WBVar01644609 |
| WBVar01445660 |
| WBVar01644610 |
| WBVar01445659 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00000229 | 5228417 | 5230536 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrIII_5230537..5230554 | 18 | III: 5230537-5230554 | Caenorhabditis elegans |
213 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_NoFood |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:bodywall-muscle_L1-larva_expressed | |
| Proteins detected in isolated mitochondria. | N.A. | WBPaper00067939:mitochondria_expressed_protein | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. | A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. | [cgc5767]:expression_class_SM | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141) | |
| Bacteria: Pseudomonas donghuensis HYS | Transcripts that showed significantly increased expression after 24 hours of infection by Pseudomonas donghuensis HYS with deletion of ferric uptake regulator (FUR), comparing to control animals exposed to HYS. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00068216:FUR_vs_HYS_upregulated |
| Bacteria: Pseudomonas donghuensis HYS | Transcripts that showed significantly decreased expression after 24 hours of infection by Pseudomonas donghuensis HYS, comparing to control animals exposed to OP50. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00068216:HYS_vs_OP50_downregulated |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Proteins interacting with GST-FBXA-210(C-terminal) via IP-MS in young adult animals. Proteins shown here are enriched in GST | Fold change > 2 and p-value < 0.1 were defined as threshold for significance. | WBPaper00068277:FBXA-210(C-terminal)_interacting_YoungAdult | |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. | DESeq2 version 1.22.2, p < 0.05 | WBPaper00064716:paraquat_downregulated | |
| Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. | DESeq fold change > 2, FDR < 0.05. | WBPaper00067499:Day10_vs_Day1_downregulated_Illumina |
12 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Also expressed in (comments from author) : high intensity GFP, other tissues may have been masked Strain: BC13747 | [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'. | Expr5420 | Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |
| Also expressed in (comments from author) : Intense GFP expression made it hard to resolve some tissues. Strain: BC10161 | [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'. | Expr5421 | Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; | |
| Strain: DM13747 | [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'. | Expr5419 | Adult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; body wall muscle; Nervous System; nerve ring; unidentified cells in head; unidentified cells in tail ; | |
| Expr2009510 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1030146 | Tiling arrays expression graphs | |||
| Expr3208 | lov-1 and atp-2 are coexpressed in the tail ray B neurons and HOB hook neuron as well as the male-specific CEM head neurons. | ATP-2::GFP is found in a broad range of tissue types, making it difficult to ascertain ciliary localization. To look more carefully at ATP-2 subcellular localization, we examined colocalization of ATP-2 and PKD-2. LOV-1 and PKD-2 exhibit identical subcellular localization patterns. PKD-2::DsRed2 localizes to cilia and cell bodies of ray, HOB, and CEM neurons. ATP-2::GFP clearly colocalizes with PKD-2::DsRed2 in CEM cilia. In rays and HOB, ciliary colocalization of ATP-2 and PKD-2 was ambiguous due to the expression of ATP-2::GFP in ray neurons, support cells, and hypodermis. | ||
| Original chronogram file: chronogram.116.xml | [C34E10.6:gfp] transcriptional fusion. | Chronogram155 | ||
| Expr1023708 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2027747 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1145903 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Original chronogram file: chronogram.947.xml | [C34E10.6:gfp] transcriptional fusion. | Chronogram2037 | ||
| Expr2043133 | Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690 |
42 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| part_of | |
| part_of | |
| located_in | |
| part_of | |
| occurs_in(GO:0005929) | enables |
| enables | |
| enables | |
| enables | |
| contributes_to | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00002025)|has_input(WB:WBGene00015574) | involved_in |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in |
7 Homologues
| Type |
|---|
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
42 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| part_of | |
| part_of | |
| located_in | |
| part_of | |
| occurs_in(GO:0005929) | enables |
| enables | |
| enables | |
| enables | |
| contributes_to | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00002025)|has_input(WB:WBGene00015574) | involved_in |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in |
3 Regulates Expr Cluster
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in glp-4(bn2);atp-2(RNAi), comparing to in glp-4(bn2) animals injected with empty vector. | Cufflinks 2.2.1 | WBPaper00060278:atp-2(RNAi)_upregulated | |
| Transcripts that showed significantly increased expression in atp-2(RNAi) comparing to in N2 animals fed with empty vector. | N.A. | WBPaper00066633:atp-2(RNAi)_upregulated | |
| Transcripts that showed significantly decreased expression in atp-2(RNAi) comparing to in N2 animals fed with empty vector. | N.A. | WBPaper00066633:atp-2(RNAi)_downregulated |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrIII_5227885..5228416 | 532 | III: 5227885-5228416 | Caenorhabditis elegans |
