WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00177549 Gene Name  CJA21977
Sequence Name  ? CJA21977 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Moulting cycle MLT-10-like protein and Moulting cycle. Is an ortholog of C. elegans mltn-3 and mltn-5. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA21977a.1 CJA21977a.1   [unknown]
Transcript:CJA21977d.1 CJA21977d.1   [unknown]
Transcript:CJA21977c.1 CJA21977c.1   [unknown]
Transcript:CJA21977b.1 CJA21977b.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA21977d CJA21977d   [unknown]
CDS:CJA21977c CJA21977c   [unknown]
CDS:CJA21977b CJA21977b   [unknown]
CDS:CJA21977a CJA21977a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA21977, GAGAAATTGAAGTTCGAGGTTGGTTTAGAGGCTTTTGATTATATCTCTAGCAGGAGTGTG, WBGene00177549   Expr1080965 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region