WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00039749 Gene Name  Cbr-lem-2
Sequence Name  ? CBG20836 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Inner nuclear membrane protein Man1; Man1/Src1, C-terminal; LEM domain; Man1-Src1p-C-terminal domain; MAN1, winged-helix domain; and LEM/LEM-like domain superfamily. Is an ortholog of C. elegans lem-2. In C. elegans, lem-2 is involved in several processes, including microtubule organizing center organization; nuclear membrane reassembly; and response to X-ray. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG20836.1 CBG20836.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG20836 CBG20836   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-lem-2, TGCTGGATATTGGGGAGTATTCAAAGCTGCTGGGAGAGATACACTCAACTTTTTCTATAA, WBGene00039749   Expr1065173 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region