WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00025054 Gene Name  CBG01882
Sequence Name  ? CBG01882 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: CBM21 domain superfamily; CBM21 (carbohydrate binding type-21) domain; Protein phosphatase 1 regulatory subunit 3B/C/D, metazoa; and Carbohydrate/starch-binding module (family 21). Is an ortholog of C. elegans H18N23.2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG01882a.1 CBG01882a.1   [unknown]
Transcript:CBG01882b.1 CBG01882b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG01882b CBG01882b   [unknown]
CDS:CBG01882a CBG01882a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG01882, CACCAAATCGAATTCTGCATCTGCTTCAAAGCGAACGGCACCGAATACTGGGACTCCAAT, WBGene00025054   Expr1052492 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region