WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00034721 Gene Name  Cbr-cnnm-3
Sequence Name  ? CBG14121 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Cyclin M transmembrane N-terminal domain and CNNM, transmembrane domain. Is an ortholog of C. elegans cnnm-3. In C. elegans, cnnm-3 is involved in several processes, including determination of adult lifespan; magnesium ion homeostasis; and positive regulation of developmental process. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG14121.1 CBG14121.1   [unknown]
Transcript:CBG14121.2 CBG14121.2   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG14121 CBG14121   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG14121, CTCCCAGTTCGAAAGAAGGGGAATCAATTGCTCTGCACTCTTATCATCGGAAACGTTATT, WBGene00034721   Expr1053719 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG14120, GAAACTTCCACTCCCATTCGCAACGGAAGTGTCAAATTGCGCACCGTAAGCGAGAGTGAA, WBGene00034720   Expr1066500 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region