WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035196 Gene Name  Cbr-ifta-1
Sequence Name  ? CBG14804 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Anaphase-promoting complex subunit 4 WD40 domain; WD40-repeat-containing domain superfamily; WD repeat protein 35; WD40 repeat; WD40/YVTN repeat-like-containing domain superfamily; and Anaphase-promoting complex subunit 4, WD40 domain. Is an ortholog of C. elegans ifta-1. In C. elegans, ifta-1 is involved in chemotaxis; intraciliary transport; and non-motile cilium assembly. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG14804.1 CBG14804.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG14804 CBG14804   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
Virus infection: Santeuil infected at L3 larva stage for 12 hours. Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264. edgeR, FDR < 0.05. WBPaper00051137:Santeuil-virus_upregulated_JU1264

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-ifta-1, TACTACTCGTGGTATGTGTGACCAAGCTGTTGAATGCTTTCTGAGACAGAATAATCCAAA, WBGene00035196   Expr1061226 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region