WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032374 Gene Name  CBG11214
Sequence Name  ? CBG11214 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Protein of unknown function DUF1258 and Protein of unknown function (DUF1258). Is an ortholog of C. elegans C36C9.4 and T25D1.2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11214.1 CBG11214.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11214 CBG11214   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG17849, TGGATTCTCATCGAAAAGTTCTAAAGTTGTAGAGGTCATTGCACCTTACAATACTCCGAT, WBGene00037364   Expr1065476 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG03230, ATATTTGGAAAGATCCGTTCTGATGTAGAAGCTCACACTGGCAGAGTTGGAATCATTACT, WBGene00026132   Expr1068125 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region