WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032433 Gene Name  Cbr-sel-9
Sequence Name  ? CBG11296 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: emp24/gp25L/p24 family/GOLD; GOLD domain superfamily; GOLD domain; and Transmembrane emp24 domain-containing protein. Is an ortholog of C. elegans sel-9. In C. elegans, sel-9 is involved in endoplasmic reticulum to Golgi vesicle-mediated transport; regulation of Notch signaling pathway; and regulation of transport. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11296.1 CBG11296.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11296 CBG11296   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-sel-9, TTGATGTCCGTGAAACACGAGCAAGAGTACATGGAAGTGAGAGAACGAGTTCACCGAAAC, WBGene00032433   Expr1051575 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region