Genomics
4 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG00592c.1 | CBG00592c.1 | [unknown] | |
| Transcript:CBG00592d.1 | CBG00592d.1 | [unknown] | |
| Transcript:CBG00592a.1 | CBG00592a.1 | [unknown] | |
| Transcript:CBG00592b.1 | CBG00592b.1 | [unknown] |
Other
4 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG00592a | CBG00592a | [unknown] | |
| CDS:CBG00592d | CBG00592d | [unknown] | |
| CDS:CBG00592b | CBG00592b | [unknown] | |
| CDS:CBG00592c | CBG00592c | [unknown] |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_downregulated | |
| Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG00592, AAAACTCGGTGACAATAATGCCATGTAACCATCGGTTTCATTTTCTGTGCCTTGTTATGT, WBGene00023965 | Expr1064658 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
