WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030835 Gene Name  CBG09205
Sequence Name  ? CBG09205 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: F-box-like domain superfamily; F-box associated region; Galactose-binding-like domain superfamily; F-box associated (FBA) domain; F-box domain; and F-box only protein. Is an ortholog of C. elegans C14B1.3. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

8 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09205a.2 CBG09205a.2   [unknown]
Transcript:CBG09205a.1 CBG09205a.1   [unknown]
Transcript:CBG09205a.4 CBG09205a.4   [unknown]
Transcript:CBG09205a.3 CBG09205a.3   [unknown]
Transcript:CBG09205b.1 CBG09205b.1   [unknown]
Transcript:CBG09205b.4 CBG09205b.4   [unknown]
Transcript:CBG09205b.3 CBG09205b.3   [unknown]
Transcript:CBG09205b.2 CBG09205b.2   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09205b CBG09205b   [unknown]
CDS:CBG09205a CBG09205a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG09205, ATGGTCCGAAAGTTGCAAATATCCAAATCCAGATAATCATGCCGGAGACTCCTATGCTGA, WBGene00030835   Expr1068456 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region