WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030019 Gene Name  CBG08167
Sequence Name  ? CBG08167 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: C-type lectin fold; MD domain; C-type lectin-like; von Willebrand factor type A domain; von Willebrand factor A-like domain superfamily; C-type lectin-like/link domain superfamily; Lectin C-type domain; and von Willebrand factor, type A. Is an ortholog of C. elegans ZK1193.2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG08167.1 CBG08167.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG08167 CBG08167   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG08167, ACTCACAACTCAATTTGTCAATACCGACTCATGGGAAGATCTACATACAGATTGTACACC, WBGene00030019   Expr1063719 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG08168, GATCAACCGGGAGTCTGGACAATTGATATAGATTATGGAATGAGCAATAGTGGACCATGT, WBGene00030020   Expr1052366 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region