Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG09800.1 | CBG09800.1 | [unknown] |
Other
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr10561 | In addition to expression in all 26 GABAergic neurons, unc-47::GFP was also sometimes expressed in two other neurons, SDQR and SDQL. Both C. elegans and C. briggsae promoters fused to GFP and introduced as extrachromosomal arrays into their endogenous environments appear to drive very weak expression in SDQR/L (about 20-fold less intense than in GABAergic neurons) in around one-third of individuals. In addition to expression in all 26 GABAergic neurons, unc-47::GFP was also sometimes expressed in two other neurons, SDQR and SDQL.Both C. elegans and C. briggsae promoters fused to GFP and introduced as extrachromosomal arrays into their endogenous environments appear to drive very weak expression in SDQR/L (about 20-fold less intense than in GABAergic neurons) in around one-third of individuals. | |||
| Cbr-unc-47, GAATCATCATAATGGGATGCAGTGTTTGCCTTTCTGGAGTCTATTTCTCATCGATGGAAC, WBGene00031320 | Expr1053705 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
