WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028368 Gene Name  CBG06022
Sequence Name  ? CBG06022 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Mitochondrial degradasome RNA helicase subunit C terminal; Helicase, C-terminal; Suv3, N-terminal; Helicase superfamily 1/2, ATP-binding domain; Helicase conserved C-terminal domain; Mitochondrial degradasome RNA helicase subunit, C-terminal domain; Suv3 helical N-terminal domain; P-loop containing nucleoside triphosphate hydrolase; Suv3 C-terminal domain 1; and Suv3, C-terminal domain 1. Is an ortholog of C. elegans C08F8.2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG06022.1 CBG06022.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG06022 CBG06022   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG06022, TGATGAATGCAATGTACTTGTCGCTACTGATGCTATTGGAATGGGACTGAATTTGAATAT, WBGene00028368   Expr1060761 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region