WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00026065 Gene Name  Cbr-kel-1
Sequence Name  ? CBG03143 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: BTB/Kelch-associated; BTB/POZ domain; BTB And C-terminal Kelch; Kelch motif; Galactose oxidase/kelch, beta-propeller; BTB-kelch protein; Kelch-type beta propeller; Kelch repeat type 1; and SKP1/BTB/POZ domain superfamily. Is an ortholog of C. elegans kel-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG03143.1 CBG03143.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG03143 CBG03143   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-kel-1, GTCTATGAGCACCAGAAGGTCGAGTGTTGGTGTAGCTGCCATTGCAGATGATATCTATGC, WBGene00026065   Expr1051923 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region