WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00023956 Gene Name  CBG00583
Sequence Name  ? CBG00583 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: HAD superfamily; HAD-like superfamily; Phosphoglycolate phosphatase-like, domain 2; and Haloacid dehalogenase-like hydrolase. Is an ortholog of C. elegans R151.10. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG00583.1 CBG00583.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG00583 CBG00583   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG24156, CCCAGAAGTTCCAGATAATGCTGGAAAAGTGTTGGTATTCGAGGACTCTTACAATGGAGT, WBGene00042333   Expr1066095 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG00583, AATTTTGGATTCACTGGAACATTTCAAACCAGAGGATTTTGGATTGCCGGCTTATGATTA, WBGene00023956   Expr1068516 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region