WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00024856 Gene Name  Cbr-col-99
Sequence Name  ? CBG01652 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Collagen triple helix repeat and Collagen triple helix repeat (20 copies). Is an ortholog of C. elegans col-99. In C. elegans, col-99 is involved in axon guidance. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

12 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG01652d.1 CBG01652d.1   [unknown]
Transcript:CBG01652e.1 CBG01652e.1   [unknown]
Transcript:CBG01652f.1 CBG01652f.1   [unknown]
Transcript:CBG01652g.1 CBG01652g.1   [unknown]
Transcript:CBG01652a.1 CBG01652a.1   [unknown]
Transcript:CBG01652b.1 CBG01652b.1   [unknown]
Transcript:CBG01652c.1 CBG01652c.1   [unknown]
Transcript:CBG01652l.1 CBG01652l.1   [unknown]
Transcript:CBG01652h.1 CBG01652h.1   [unknown]
Transcript:CBG01652i.1 CBG01652i.1   [unknown]
Transcript:CBG01652j.1 CBG01652j.1   [unknown]
Transcript:CBG01652k.1 CBG01652k.1   [unknown]
 

Other

12 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG01652a CBG01652a   [unknown]
CDS:CBG01652b CBG01652b   [unknown]
CDS:CBG01652c CBG01652c   [unknown]
CDS:CBG01652d CBG01652d   [unknown]
CDS:CBG01652e CBG01652e   [unknown]
CDS:CBG01652f CBG01652f   [unknown]
CDS:CBG01652g CBG01652g   [unknown]
CDS:CBG01652h CBG01652h   [unknown]
CDS:CBG01652i CBG01652i   [unknown]
CDS:CBG01652j CBG01652j   [unknown]
CDS:CBG01652k CBG01652k   [unknown]
CDS:CBG01652l CBG01652l   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day1_upregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-col-99, GAGTACAAGGACCACCAGGAATACCAGGAGAGCCTGGAAGAACAATCATTGGACCGCAAG, WBGene00024856   Expr1056581 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG26442, GCACAACAAACACGCATATCGACGCTTGAGAGACGCATCGATCAGCTTGCCGTTCAGGTA, WBGene00087856   Expr1052701 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region