WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00216178 Gene Name  CJA40330
Sequence Name  ? CJA40330 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Translation initiation factor eIF-2B subunit alpha, N-terminal; Initiation factor 2B-related; Initiation factor 2 subunit family; Initiation factor 2B-like, C-terminal; and NagB/RpiA transferase-like. Is an ortholog of C. elegans eif-2Balpha. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA40330.1 CJA40330.1   [unknown]
Transcript:CJA40330.3 CJA40330.3   [unknown]
Transcript:CJA40330.2 CJA40330.2   [unknown]
Transcript:CJA40330.4 CJA40330.4   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA40330 CJA40330   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA08009, TGAACCAGGCGGACATTCCAAAAGAATTCCTGTATCGAACATCGGTGATCGAGAAGAACA, WBGene00127213   Expr1073874 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA03371, CGAATCGCAACCGGACGCTTCTGGAAAACACATGTTTGAAGAGTTGAAGAAACACGGTGT, WBGene00122575   Expr1078514 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region