WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00210074 Gene Name  CJA34227
Sequence Name  ? CJA34227 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domain: Tetratricopeptide-like helical domain superfamily. Is an ortholog of C. elegans bbs-4. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

5 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA34227a.1 CJA34227a.1   [unknown]
Transcript:CJA34227b.1 CJA34227b.1   [unknown]
Transcript:CJA34227e.1 CJA34227e.1   [unknown]
Transcript:CJA34227c.1 CJA34227c.1   [unknown]
Transcript:CJA34227d.1 CJA34227d.1   [unknown]
 

Other

5 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA34227e CJA34227e   [unknown]
CDS:CJA34227d CJA34227d   [unknown]
CDS:CJA34227c CJA34227c   [unknown]
CDS:CJA34227b CJA34227b   [unknown]
CDS:CJA34227a CJA34227a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA19013, GAAAGATTTCAGCTCTTCTTGGAAAGCTCTCAGCATCTACAAAGAGCTTCAGTCGGCGGG, WBGene00138217   Expr1092065 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region