WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030374 Gene Name  Cbr-let-413
Sequence Name  ? CBG08615 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Leucine-rich repeat domain superfamily; Leucine-rich repeat; Leucine-rich repeat, typical subtype; and Leucine rich repeat. Is an ortholog of C. elegans let-413. In C. elegans, let-413 is involved in several processes, including cell-cell junction assembly; maintenance of epithelial cell apical/basal polarity; and regulation of cellular component organization. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG08615a.1 CBG08615a.1   [unknown]
Transcript:CBG08615c.1 CBG08615c.1   [unknown]
Transcript:CBG08615b.1 CBG08615b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG08615a CBG08615a   [unknown]
CDS:CBG08615c CBG08615c   [unknown]
CDS:CBG08615b CBG08615b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-let-413, AAACACCGAAACACAAGAAGGGATCGATAGATGGACATATGGCACCACACGATACGGATC, WBGene00030374   Expr1053247 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region