WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00037582 Gene Name  Cbr-dcn-1
Sequence Name  ? CBG18096 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: UBA-like superfamily; Defective-in-cullin neddylation protein; Cullin binding; UBA-like domain; and Potentiating neddylation domain. Is an ortholog of C. elegans dcn-1. In C. elegans, dcn-1 is involved in microtubule cytoskeleton organization; protein catabolic process; and protein neddylation. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG18096.1 CBG18096.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG18096 CBG18096   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-dcn-1, GCAAAGAGGATCTTTCTGATTACGACGAGGAAGGAGCATGGCCAGTTCTCATCGATCAAT, WBGene00037582   Expr1067868 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region