Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG26323.1 | CBG26323.1 | [unknown] |
Other
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Heat shock: 34C 30min. | Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. | DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. | WBPaper00058955:heatshock_upregulated_CBG |
| Virus infection: Santeuil infected at L3 larva stage for 12 hours. | Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264. | edgeR, FDR < 0.05. | WBPaper00051137:Santeuil-virus_upregulated_JU1264 |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG26323, CCAGCAGATGCCAGATTCCATTCAATGTCTTCCCTTCACTCGAAAAGATGATCAATTATC, WBGene00087737 | Expr1051778 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
