WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00082869 Gene Name  Cre-num-1
Sequence Name  ? CRE21142 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: PTB/PI domain; PH-like domain superfamily; Phosphotyrosine interaction domain (PTB/PID); and NUMB domain. Is an ortholog of C. elegans num-1. In C. elegans, num-1 is involved in endocytic recycling; phospholipid transport; and protein targeting to membrane. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE21142.1 CRE21142.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE21142 CRE21142   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-num-1, GGAATGACAGTTTGTGAAGGAGCGTTGAAATCATTGAAAGCGACGAGGAGGAAACCGGTG, WBGene00082869   Expr1095622 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region