WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035563 Gene Name  Cbr-grk-2
Sequence Name  ? CBG15249 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Regulator of G protein signaling domain; RGS domain; RGS domain superfamily; and Protein kinase-like domain superfamily. Is an ortholog of C. elegans grk-2. In C. elegans, grk-2 is involved in several processes, including positive regulation of egg-laying behavior; positive regulation of growth rate; and serotonin catabolic process. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG15249.1 CBG15249.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG15249 CBG15249   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-grk-2, AAATCTGGAATTGAATATGCAATTGACCATGAACGACTTTTCCGTGCATCGGATTATTGG, WBGene00035563   Expr1060997 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region