WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00181855 Gene Name  CJA26283
Sequence Name  ? CJA26283 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Domain of unknown function; Tc5 transposase C-terminal domain; Domain of unknown function WSN; P-loop containing nucleoside triphosphate hydrolase; DNA2/NAM7 helicase-like, C-terminal; AAA domain; and Transposase, Tc5, C-terminal. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA26283.1 CJA26283.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA26283 CJA26283   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA03433, TCCCGTACAAGGAACGAATGACGAGAGAGGAATGTTTCCTCAAAATCCACCAAACTTCAG, WBGene00122637   Expr1074059 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region