WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00026659 Gene Name  Cbr-afd-1
Sequence Name  ? CBG03894 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: PDZ domain; Dilute domain; PDZ superfamily; and DIL domain. Is an ortholog of C. elegans afd-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG03894b.1 CBG03894b.1   [unknown]
Transcript:CBG03894a.1 CBG03894a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG03894b CBG03894b   [unknown]
CDS:CBG03894a CBG03894a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-afd-1, TTGATGAAGTATCGCAATACCAAACACCAACCAGCAACACAGCCATGTTGTTCGCTGCTG, WBGene00026659   Expr1059886 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG25237, CGGAGCCGATCATCTATTCAAATTCAGTGGTGGTCCTCAAGCGAACCAAAAACATTTCCA, WBGene00086651   Expr1062137 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region