WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00034594 Gene Name  Cbr-ubxn-2
Sequence Name  ? CBG13914 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Ubiquitin-like domain superfamily; NSFL1 cofactor p47, SEP domain superfamily; SEP domain; and UBX domain. Is an ortholog of C. elegans ubxn-2. In C. elegans, ubxn-2 is involved in several processes, including developmental process involved in reproduction; establishment of mitotic spindle orientation; and negative regulation of protein localization to centrosome. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG13914.1 CBG13914.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG13914 CBG13914   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L4_vs_embryo_upregulated
  C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L1_vs_embryo_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-ubxn-2, GAAAGTTCTCATCGACGAGACGCAGACACTGAAAGAGGCCAATCTGCTGAATTCGGTGAT, WBGene00034594   Expr1062091 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region