WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00181621 Gene Name  Cjp-pdpr-1
Sequence Name  ? CJA26049 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: FAD dependent oxidoreductase; FAD dependent oxidoreductase, central domain; Aminomethyltransferase, folate-binding domain; Aminomethyltransferase folate-binding domain; FAD dependent oxidoreductase central domain; FAD/NAD(P)-binding domain superfamily; and GTP-binding protein TrmE/Aminomethyltransferase GcvT, domain 1. Is an ortholog of C. elegans pdpr-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA26049a.1 CJA26049a.1   [unknown]
Transcript:CJA26049b.1 CJA26049b.1   [unknown]
Transcript:CJA26049c.1 CJA26049c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA26049a CJA26049a   [unknown]
CDS:CJA26049b CJA26049b   [unknown]
CDS:CJA26049c CJA26049c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA26049, CAGCGAGTACGAGGCGTGTCGAGAAAGAGTAGGATTGATGGATATGAGCAGTTTCAGCAA, WBGene00181621   Expr1074257 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region