WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00077422 Gene Name  Cre-phlp-2
Sequence Name  ? CRE01121 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Leucine-rich repeat, typical subtype; PPM-type phosphatase domain superfamily; Leucine-rich repeat; Leucine rich repeat; PPM-type phosphatase domain; Protein phosphatase 2C; and Leucine-rich repeat domain superfamily. Is an ortholog of C. elegans phlp-2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE01121.1 CRE01121.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE01121 CRE01121   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE01121, CTAGGGATTTGTTGAGTAAATCATTGAAGTTGAGCCCTCCGAATACGGTCACTTTTAATA, WBGene00077422   Expr1107916 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region