WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00075970 Gene Name  Cre-exc-9.1
Sequence Name  ? CRE31620 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: LIM domain and Zinc finger, LIM-type. Is an ortholog of C. elegans exc-9. In C. elegans, exc-9 is involved in anatomical structure morphogenesis; epithelial cell development; and regulation of tube size. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE31620.1 CRE31620.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE31620 CRE31620   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-exc-9, GTCCATGTCTCCGATGCGAAAATGAGGCTTGCAAGAAGACGTTGGCAGCTGGAAGTCACT, WBGene00059376   Expr1107235 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region