WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00034003 Gene Name  Cbr-gly-9
Sequence Name  ? CBG13209 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Ricin B, lectin domain; Nucleotide-diphospho-sugar transferases; Glycosyl transferase family 2; Ricin-type beta-trefoil lectin domain; Ricin B-like lectins; and Glycosyltransferase 2-like. Is an ortholog of C. elegans gly-9. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG13209b.1 CBG13209b.1   [unknown]
Transcript:CBG13209a.1 CBG13209a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG13209a CBG13209a   [unknown]
CDS:CBG13209b CBG13209b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-gly-9, CTGGCGACGATGCAATTGTGGTGGAATGCGACGAAAACGATGCACATCAAAAGTGGAACT, WBGene00034003   Expr1065748 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region