WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00073750 Gene Name  CRE18315
Sequence Name  ? CRE18315 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Hsp20/alpha crystallin family; Alpha crystallin/Hsp20 domain; Alpha crystallin/Small heat shock protein, animal type; and HSP20-like chaperone. Is an ortholog of C. elegans hsp-16.1; hsp-16.11; and hsp-16.2. In C. elegans, hsp-16.1 is involved in defense response to Gram-negative bacterium; endoplasmic reticulum unfolded protein response; and response to heat. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE18315.1 CRE18315.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE18315 CRE18315   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE18315, AAGAAGGTCGCGGTTCAAGGGAGAGCAATTCCGATTACTCAGTCTGCTGCAGAAGAGAAG, WBGene00073750   Expr1092362 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region