WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00070898 Gene Name  Cre-spp-8
Sequence Name  ? CRE10710 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Saposin B type domain; Saposin-like type B, region 2; Saposin B type, region 2; and Saposin-like. Is an ortholog of C. elegans spp-8. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE10710.1 CRE10710.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE10710 CRE10710   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE21050, CTTGACCTACAATCAATTCGACGGAAAGGGAATCTGTACTGCAATGCATACTTGTGAGAA, WBGene00074024   Expr1098756 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cre-spp-8, CAAGCCAGAGAAGGCCATGATCGGATGTGAGCACTGTCAAGCCGTAGAGCAATTCATTGC, WBGene00070898   Expr1115063 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region