WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00027021 Gene Name  Cbr-icd-1
Sequence Name  ? CBG04320 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: NAC A/B domain superfamily; Nascent polypeptide-associated complex NAC domain; NAC domain; and Transcription factor BTF3. Is an ortholog of C. elegans icd-1. In C. elegans, icd-1 is involved in embryo development and negative regulation of apoptotic process. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG04320.1 CBG04320.1   [unknown]
Transcript:CBG04320.2 CBG04320.2   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG04320 CBG04320   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-icd-1, AACATGATCAAGGACGACGGAACTGTTATCCATTTCAACAACCCAAAAGTCCAGACCTCT, WBGene00027021   Expr1059773 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region